RegulonDB RegulonDB 10.8: Gene Sequence
pncB gene sequence


Size: 1203        A: 274  T: 313  G: 306  C: 310

Fasta

 

>pncB E. coli K12. Version NC_000913.3 GI:556503834
atgacacaattcgcttctcctgttctgcactcgttgctggatacagatgcttataagttg
catatgcagcaagccgtgtttcatcactattacgatgtgcatgtcgcggcggagtttcgt
tgccgaggtgacgatctgctgggtatttatgccgatgctattcgtgaacaggttcaggcg
atgcagcacctgcgcctgcaggatgatgaatatcagtggctttctgccctgcctttcttt
aaggccgactatcttaactggttacgcgagttccgctttaacccggaacaagtcaccgtg
tccaacgataatggcaagctggatattcgtttaagcggcccgtggcgtgaagtcatcctc
tgggaagttcctttgctggcggttatcagtgaaatggtacatcgctatcgctcaccgcag
gccgacgttgcgcaagccctcgacacgctggaaagcaaattagtcgacttctcggcgtta
accgccggtcttgatatgtcgcgcttccatctgatggattttggcacccgtcgccgtttt
tctcgcgaagtacaagaaaccatcgttaagcgtctgcaacaggaatcctggtttgtgggc
accagcaactacgatctggcgcgtcggctttccctcacgccgatgggaacacaggcacac
gaatggttccaggcacatcagcaaatcagcccggatctagccaacagccagcgagctgca
cttgctgcctggctggaagagtatcccgaccaacttggcattgcattaaccgactgcatc
actatggatgctttcctgcgtgatttcggtgtcgagttcgctagtcggtatcagggcctg
cgtcatgactctggcgacccggttgaatggggtgaaaaagccattgcacattatgaaaag
ctgggaattgatccacagagtaaaacgctggttttctctgacaatctggatttacgcaaa
gcggttgagctataccgccacttctcttcccgcgtgcaattaagttttggtattgggact
cgcctgacctgcgatatcccccaggtaaaacccctgaatattgtcattaagttggtagag
tgtaacggtaaaccggtggcgaaactttctgacagccctggcaaaactatctgccatgat
aaagcgtttgttcgggcgctgcgcaaagcgttcgaccttccgcatattaaaaaagccagt
taa
              
                            

Download fasta file
RegulonDB