RegulonDB RegulonDB 10.9: Gene Sequence
ppa gene sequence


Size: 531        A: 147  T: 112  G: 133  C: 139

Fasta

 

>ppa E. coli K12. Version NC_000913.3 GI:556503834
atgagcttactcaacgtccctgcgggtaaagatctgccggaagacatctacgttgttatt
gagatcccggctaacgcagatccgatcaaatacgaaatcgacaaagagagcggcgcactg
ttcgttgaccgcttcatgtccaccgcgatgttctatccatgcaactacggttacatcaac
cacaccctgtctctggacggtgacccggttgacgtactggtcccaactccgtacccgctg
cagccgggttctgtgatccgttgccgtccggttggcgttctgaaaatgaccgacgaagcc
ggtgaagatgcgaaactggttgcggttccgcacagcaagctgagcaaagaatacgatcac
attaaagacgttaacgatctgcctgaactgctgaaagcgcaaatcgctcacttcttcgag
cactacaaagacctcgaaaaaggcaagtgggtgaaagttgaaggttgggaaaacgcagaa
gccgctaaagctgaaatcgttgcctccttcgagcgcgcaaagaataaataa
              
                            

Download fasta file
RegulonDB