RegulonDB RegulonDB 10.8: Gene Sequence
ppiB gene sequence


Size: 495        A: 146  T: 112  G: 118  C: 119

Fasta

 

>ppiB E. coli K12. Version NC_000913.3 GI:556503834
atggttactttccacaccaatcacggcgatattgtcatcaaaacttttgacgataaagca
cctgaaacagttaaaaacttcctggactactgccgcgaaggtttttacaacaacaccatt
ttccaccgtgttatcaacggctttatgattcagggcggcggttttgaaccgggcatgaaa
caaaaagccaccaaagaaccgatcaaaaacgaagccaacaacggcctgaaaaatacccgt
ggtacgctggcaatggcacgtactcaggctccgcactctgcaactgcacagttcttcatc
aacgtggttgataacgacttcctgaacttctctggcgaaagcctgcaaggttggggctac
tgcgtgtttgctgaagtggttgacggcatggacgtggtagacaaaatcaaaggtgttgca
accggtcgtagcggtatgcaccaggacgtgccaaaagaagacgttatcattgaaagcgtg
accgttagcgagtaa
              
                            

Download fasta file
RegulonDB