RegulonDB RegulonDB 10.8: Gene Sequence
proX gene sequence


Size: 993        A: 273  T: 198  G: 261  C: 261

Fasta

 

>proX E. coli K12. Version NC_000913.3 GI:556503834
atgcgacatagcgtactttttgcgacagcgtttgccacgcttatctctacacaaactttt
gctgccgatctgccgggcaaaggcattactgttaatccagttcagagcaccatcactgaa
gaaaccttccagacgctgctggtcagtcgtgcgctggagaaattaggttataccgtcaac
aaacccagcgaagtagattacaacgttggctacacctcgcttgcttccggcgatgcaacc
ttcaccgccgtgaactggacgccactgcatgacaacatgtacgaagctgccggtggcgat
aagaaattttatcgtgaaggggtatttgttaacggcgcggcacagggttacctgatcgat
aagaaaaccgccgaccagtacaaaatcaccaacatcgcacaactgaaagatccgaagatc
gccaaactgttcgataccaacggcgacggaaaagcggatttaaccggttgtaaccctggc
tggggctgcgaaggtgcgatcaaccaccagcttgccgcgtatgaactgaccaacaccgtg
acgcataatcaggggaactacgcagcgatgatggccgacaccatcagtcgctacaaagag
ggcaaaccggtgttttattacacctggacgccgtactgggtgagtaacgaactgaagccg
ggcaaagatgtcgtctggttgcaggtgccgttctccgcactgccgggcgataaaaacgcc
gataccaaactgccgaatggtgcgaattatggcttcccggtcagcaccatgcatatcgtt
gccaacaaagcctgggccgagaaaaacccggcagcagcgaaactgtttgccattatgcag
ttgccagtggcagatattaacgcccagaacgccattatgcatgacggcaaagcctcagaa
ggcgatattcagggacacgttgatggttggatcaaagcccaccagcagcagttcgatggc
tgggtgaatgaggcgctggcagcgcagaagtaa
              
                            

Download fasta file
RegulonDB