RegulonDB RegulonDB 10.10: Gene Sequence
psd gene sequence


Size: 969        A: 236  T: 215  G: 252  C: 266

Fasta

 

>psd E. coli K12. Version NC_000913.3 GI:556503834
ttgttaaattcatttaaactttcgctacagtacattctgccgaaactatggcttactcgc
ctggcgggttggggcgcaagcaagcgggcaggatggctgacaaaactggttatcgatctg
ttcgttaaatactacaaggtcgacatgaaagaggcgcaaaagccggacaccgccagctac
cgcacctttaacgaattctttgtccgtccgctgcgtgacgaagtacgcccaatcgatacc
gatccgaatgtactggtcatgcctgccgatggcgttatcagccagttgggtaaaatcgaa
gaagataaaatcctgcaagccaaaggccacaactacagcctcgaagccctgctggcaggc
aactatctgatggcggacctgttccgcaacggtacgtttgtgaccacttacctctccccg
cgtgactaccaccgcgtacacatgccgtgcaacggtattctgcgtgagatgatctacgtg
ccgggcgatctcttctccgttaaccatctcacggctcagaacgtgccgaatctgtttgcc
cgtaacgaacgcgtgatttgccttttcgataccgaatttggcccaatggcgcagattctg
gtcggagcgacgattgttggcagcattgagacggtctgggcgggcaccattacgccgccg
cgcgaaggtatcatcaagcgctggacctggcctgccggggaaaacgacggttctgtggca
ctgctgaaaggccaggaaatgggtcgctttaaactcggttccaccgttatcaacctgttt
gcaccgggtaaagtgaatctggttgagcaactggaaagcctgtctgtcacgaaaattggc
cagccgctggcagtatctaccgaaacctttgttacgccagacgctgaacctgccccgctt
cctgctgaagagatcgaagcagaacacgacgccagcccattggttgacgacaaaaaagac
caggtctaa
              
                            

Download fasta file
RegulonDB