RegulonDB RegulonDB 10.9: Gene Sequence
pstB gene sequence


Size: 774        A: 193  T: 176  G: 201  C: 204

Fasta

 

>pstB E. coli K12. Version NC_000913.3 GI:556503834
atgagtatggttgaaactgccccgagtaaaattcaggttcgtaatttgaacttctactac
ggcaaattccatgccctgaaaaacatcaacctggatatcgctaaaaaccaggtaacggcg
tttatcgggccgtccggctgcggtaaatcgacgctgctgcgtaccttcaacaaaatgttt
gaactgtacccggagcagcgtgcggaaggtgaaattctgcttgatggcgacaacatcctg
accaactctcaggatatcgcactgctgcgtgcgaaagtgggcatggtgttccagaaaccg
acgccgtttccgatgtccatctacgacaacatcgcttttggcgttcgtctgtttgagaag
ctctcccgtgccgacatggacgagcgcgtgcagtgggcattgaccaaagccgcattgtgg
aacgaaaccaaagataaattgcaccagagcggttactctctctctggtggtcagcaacag
cgtctgtgtattgcgcgtggtatcgccattcgcccggaagtgctgctgctcgacgaaccg
tgttcggcgctcgaccctatctctaccgggcgtattgaagagctgatcaccgaactgaag
caggattacaccgtggtgatcgtcacccacaacatgcagcaggctgcgcgttgttccgac
cacacggcgtttatgtacctgggcgaattgattgagttcagcaacacggacgatctgttc
accaagccagcgaagaaacaaacagaagactacatcaccggtcgttacggttga
              
                            

Download fasta file
RegulonDB