RegulonDB RegulonDB 10.8: Gene Sequence
ptsH gene sequence


Size: 258        A: 73  T: 54  G: 64  C: 67

Fasta

 

>ptsH E. coli K12. Version NC_000913.3 GI:556503834
atgttccagcaagaagttaccattaccgctccgaacggtctgcacacccgccctgctgcc
cagtttgtaaaagaagctaagggcttcacttctgaaattactgtgacttccaacggcaaa
agcgccagcgcgaaaagcctgtttaaactgcagactctgggcctgactcaaggtaccgtt
gtgactatctccgcagaaggcgaagacgagcagaaagcggttgaacatctggttaaactg
atggcggaactcgagtaa
              
                            

Download fasta file
RegulonDB