RegulonDB RegulonDB 10.9: Gene Sequence
putA gene sequence


Size: 3963        A: 858  T: 847  G: 1181  C: 1077

Fasta

 

>putA E. coli K12. Version NC_000913.3 GI:556503834
atgggaaccaccaccatgggggttaagctggacgacgcgacgcgtgagcgtattaagtct
gccgcgacacgtatcgatcgcacaccacactggttaattaagcaggcgattttttcttat
ctcgaacaactggaaaacagcgatactctgccggagctacctgcgctgctttctggcgcg
gccaatgagagcgatgaagcaccgactccggcagaggaaccacaccagccattcctcgac
tttgccgagcaaatattgccccagtcggtttcccgcgccgcgatcaccgcggcctatcgc
cgcccggaaaccgaagcggtttctatgctgctggaacaagcccgcctgccgcagccagtt
gctgaacaggcgcacaaactggcgtatcagctggccgataaactgcgtaatcaaaaaaat
gccagtggtcgcgcaggtatggtccaggggttattgcaggagttttcgctgtcatcgcag
gaaggcgtggcgctgatgtgtctggcggaagcgttgttgcgtattcccgacaaagccacc
cgcgacgcgttaattcgcgacaaaatcagcaacggtaactggcagtcacacattggtcgt
agcccgtcactgtttgttaatgccgccacctgggggctgctgtttactggcaaactggtt
tccacccataacgaagccagcctctcccgctcgctgaaccgcattatcggtaaaagcggt
gaaccgctgatccgcaaaggtgtggatatggcgatgcgcctgatgggtgagcagttcgtc
actggcgaaaccatcgcggaagcgttagccaatgcccgcaagctggaagagaaaggtttc
cgttactcttacgatatgctgggcgaagccgcgctgaccgccgcagatgcacaggcgtat
atggtttcctatcagcaggcgattcacgccatcggtaaagcgtctaacggtcgtggcatc
tatgaagggccgggcatttcaatcaaactgtcggcgctgcatccgcgttatagccgcgcc
cagtatgaccgggtaatggaagagctttacccgcgtctgaaatcactcaccctgctggcg
cgtcagtacgatattggtatcaacattgacgccgaagagtccgatcgcctggagatctcc
ctcgatctgctggaaaaactctgtttcgagccggaactggcaggctggaacggcatcggt
tttgttattcaggcttatcaaaaacgctgcccgttggtgatcgattacctgattgatctc
gccacccgcagccgtcgccgtctgatgattcgcctggtgaaaggcgcgtactgggatagt
gaaattaagcgtgcgcagatggacggccttgaaggttatccggtttatacccgcaaggtg
tataccgacgtttcttatctcgcctgtgcgaaaaagctgctggcggtgccgaatctaatc
tacccgcagttcgcgacgcacaacgcccatacgctggcggcgatttatcaactggcgggg
cagaactactacccgggtcagtacgagttccagtgcctgcatggtatgggcgagccactg
tatgagcaggtcaccgggaaagttgccgacggcaaacttaaccgtccgtgtcgtatttat
gctccggttggcacacatgaaacgctgttggcgtatctggtgcgtcgcctgctggaaaac
ggtgctaacacctcgtttgttaaccgtattgccgacacctctttgccactggatgaactg
gtcgccgatccggtcactgctgtagaaaaactggcgcaacaggaagggcaaactggatta
ccgcatccgaaaattcccctgccgcgcgatctttacggtcacgggcgcgacaactcggca
gggctggatctcgctaacgaacaccgcctggcctcgctctcctctgccctgctcaatagt
gcactgcaaaaatggcaggccttgccaatgctggaacaaccggtagcggcaggtgagatg
tcgcccgttattaaccctgcggaaccgaaagatattgtgggctatgtgcgtgaagccacg
ccgcgtgaagtagaacaggcgctggaaagtgcggttaataacgcgccaatctggtttgcc
acgcctccggctgaacgcgcagcgattttgcaccgcgctgccgtgctgatggaaagccag
atgcagcaactgattggtattctggtgcgtgaggccggaaaaaccttcagtaacgccatt
gccgaagtgcgcgaagcggtcgattttctccactactacgccggacaggtgcgggatgat
ttcgctaacgaaacccaccgtccattagggcctgtggtgtgtatcagtccgtggaacttc
ccgctggctattttcaccgggcagatcgccgccgcactggcggcaggtaacagcgtgctg
gcaaaaccggcagaacaaacgccgctgattgccgcgcaagggatcgccattttgctggaa
gcgggtgtaccgccaggcgtggtgcaattgctgccaggtcggggtgaaaccgtgggcgcg
caactgacgggtgatgatcgcgtgcgcggggtgatgtttaccggttcaaccgaagtcgct
acgttactgcagcgcaatatcgccagccgcctggacgctcagggtcgccctattccgctc
atcgctgaaaccggcggcatgaacgcgatgattgtcgattcttcagcactgaccgaacag
gtcgtcgtggatgtactggcctcggcgttcgacagtgcgggtcagcgttgttcggcgctg
cgcgtgctgtgcctgcaagatgagattgccgaccacacgttgaaaatgctgcgcggcgca
atggccgaatgccggatgggtaatccgggtcgcctgaccaccgatatcggtccagtgatt
gatagcgaagcgaaagccaatattgagcgccatattcagaccatgcgtagcaaaggccgt
ccggtgttccaggcggtgcgggaaaacagcgaagatgcccgtgaatggcaaagcggcacc
tttgtcgccccgacgctgatcgaactggatgactttgccgaattgcaaaaagaggtcttt
ggtccggtgctgcatgtggtgcgttacaaccgtaaccagctaccagagctgatcgagcag
attaacgcttccggttatggtctgacgcttggcgtccatacgcgcattgatgaaaccatc
gcccaggtcactggctcggcccatgttggtaacctgtatgttaaccgtaatatggtgggc
gcagtggttggtgtgcagccgttcggcggcgaagggttgtccggtaccgggccgaaagca
ggcggtccgctctatctctaccgtctgctggcgaatcgcccggaaagtgcgctggcagtg
acgctcgcgcgtcaggatgcaaagtatccggtcgatgcgcagttgaaagccgcattgact
cagccgctaaatgcactgcgggaatgggcagcaaatcgtccagaattgcaggcgttatgt
acgcaatatggcgagctggcgcaggcaggaacacaacgattgctgccggggccgacgggt
gaacgcaacacctggacgctgctgccgcgtgagcgcgtgttgtgtattgccgatgatgag
caggatgcgctgactcagctcgccgccgtgctggcggtgggcagccaggtactgtggccg
gatgacgcgctgcatcgtcagttagtgaaggcattgccatcggcagtcagcgaacgtatt
caactggcgaaagcggaaaatataaccgctcaaccgtttgatgcggtgatcttccacggt
gattcggatcagcttcgcgcattgtgtgaagcagttgccgcgcgggatggcacaattgtt
tcggtgcagggttttgcccgtggcgaaagcaatatccttctggaacggctgtatatcgag
cgttcgctgagtgtgaataccgctgccgctggcggtaacgccagcttaatgactataggt
taa
              
                            

Download fasta file
RegulonDB