RegulonDB RegulonDB 10.8: Gene Sequence
pyrF gene sequence


Size: 738        A: 151  T: 196  G: 215  C: 176

Fasta

 

>pyrF E. coli K12. Version NC_000913.3 GI:556503834
atgacgttaactgcttcatcttcttcccgcgctgttacgaattctcctgtggttgttgcc
cttgattatcataatcgtgatgacgcgctggcctttgtcgacaagatcgacccacgcgat
tgtcgtctgaaggtcggcaaagagatgtttacattgtttgggccacagtttgtgcgcgaa
cttcaacagcgtggttttgatatctttcttgacctgaaattccacgatatccccaacact
gcagcgcacgctgtcgctgctgcagctgacttaggcgtgtggatggtgaatgttcatgcc
tctggtggggcgcgtatgatgaccgcagcgcgtgaggcactggttccgtttggcaaagat
gcaccgcttttgattgctgtgacagtgttgaccagcatggaagccagcgacctggtcgat
cttggcatgacactgtcacctgcagattatgcagaacgtctggcggcactgacgcaaaaa
tgtggccttgatggtgtggtgtgttctgctcaggaagctgtgcgctttaaacaggtattc
ggtcaggagttcaaactggttacgccgggcattcgtccgcaggggagtgaagctggtgac
cagcgccgcattatgacgccagaacaggcgttgtcggctggtgttgattatatggtgatt
ggtcgcccggtaacgcaatcggtagatccagcgcagacgctgaaagcgatcaacgcctct
ttacagcggagtgcatga
              
                            

Download fasta file
RegulonDB