RegulonDB RegulonDB 10.8: Gene Sequence
pyrG gene sequence


Size: 1638        A: 398  T: 390  G: 444  C: 406

Fasta

 

>pyrG E. coli K12. Version NC_000913.3 GI:556503834
atgacaacgaactatatttttgtgaccggcggggtcgtatcctctctgggtaaaggcatt
gccgcagcctccctcgcagccattcttgaagcccgtggcctcaatgtgaccatcatgaaa
ctggatccgtacatcaacgtcgatccaggtactatgagcccaatccaacacggggaagtg
ttcgttactgaagacggcgctgaaaccgacctggacctggggcactacgagcgtttcatt
cgtaccaaaatgagccgccgcaacaacttcaccacgggtcgtatctactctgacgttctg
cgtaaagaacgccgcggtgactacctcggcgcaaccgtgcaggttattccgcacatcact
aacgcaatcaaagagcgcgtgctggaaggtggcgaaggtcatgacgtagtactggtagaa
atcggcggtacagtaggtgatatcgaatccttgccgttcctcgaagcgattcgccagatg
gctgttgaaattggccgtgagcacactctgtttatgcacctgacgctggtgccgtacatg
gcagcgtctggtgaagtcaaaaccaaaccgactcagcactctgtaaaagagctgctctcc
atcggtatccagcctgacatcctgatttgtcgttcagatcgcgctgttccggcgaacgaa
cgtgcgaagattgcattgttctgtaatgttccggaaaaagcggttatttctctgaaagac
gtcgattccatctataaaattccgggcctgttgaaatctcaggggctggacgattatatt
tgtaaacgattcagcttaaactgcccggaagcgaatctgtccgaatgggaacaggttatc
ttcgaagaagcgaacccggtaagtgaagtcaccatcggtatggtcggcaagtacattgaa
ctgccggatgcttataaatcagtgatcgaagcactgaaacacggtgggctgaagaatcgt
gtcagcgtcaacatcaaactgatcgattcacaagatgttgaaacgcgcggcgttgaaatc
cttaaaggtctggacgcaatcctcgtacctggcggtttcggctatcgtggcgtagaaggc
atgattacgaccgcgcgttttgcgcgtgagaacaatattccttatctgggcatttgcctg
ggtatgcaggtggcgttaattgattacgctcgccatgttgccaacatggagaacgccaac
tctacggaatttgtgccagactgtaagtacccggttgtggcgctgattaccgagtggcgc
gatgaaaacggcaacgttgaagttcgtagcgagaagagcgatctcggcggtaccatgcgt
ctcggcgcacagcagtgccagttggttgacgatagcctggttcgccagctgtacaatgcg
ccgacaattgttgagcgtcatcgtcaccgttacgaagtcaacaacatgctgttgaaacag
attgaagatgcaggtctgcgcgttgcgggccgttccggggatgatcagttggtcgagatc
atcgaagttccgaatcacccgtggttcgtggcttgccagttccatccggagtttacttct
actccacgtgatggtcacccgctgtttgcaggctttgtgaaagccgccagcgagttccag
aaacgtcaggcgaagtaa
              
                            

Download fasta file
RegulonDB