RegulonDB RegulonDB 10.8: Gene Sequence
queA gene sequence


Size: 1071        A: 246  T: 245  G: 295  C: 285

Fasta

 

>queA E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgttaccgatttctcctttgaattgcccgaatccctgattgcccactatcccatg
cctgaacgcagtagctgtcgtttactgtcgctggacgggccgacgggcgcgctgacgcac
ggtactttcaccgatttacttgataagctcaaccccggcgatcttctggtttttaataat
acccgcgtgatcccggcgcgcctgtttgggcgtaaagccagcggcggcaagattgaagtg
ctggttgaacggatgctcgacgacaaacgcattcttgcgcatattcgcgcctcgaaagcg
ccaaaacctggcgcagaactgctgctgggcgatgacgaaagtattaacgcaacaatgacc
gcgcgccacggcgcactgtttgaagtcgaatttaatgatgaacgctcggtgctggatatt
ctcaacagcatcggccatatgccgctgccgccgtatatcgaccgtccggacgaagacgct
gaccgcgaactttatcaaaccgtttatagcgaaaaaccgggcgcggttgcagccccgacc
gcaggtctgcattttgacgagcctttgctggaaaaattgcgcgccaaaggcgtggagatg
gcgtttgtgacgttgcacgttggtgcgggcaccttccagccggtgcgcgtcgacaccatt
gaagatcacatcatgcactcggaatacgctgaagtaccgcaggatgtggtagacgcggta
ctggcggcgaaagcgcgcggtaaccgggtgattgcggttggcaccacttcagtacgttcg
ctggaaagcgcggctcaggcagcgaaaaacgatctcattgaaccgttcttcgacgatacc
caaatctttatctatccgggcttccagtacaaagtggtcgatgcgctggtgacgaacttc
cacttgccagagtcgacgctgattatgctggtttcggcctttgccggttatcaacacacc
atgaacgcctataaagcagcggtagaagagaaatatcgcttttttagttacggtgatgcg
atgtttatcacgtacaatccgcaggcaattaatgagcgcgtcggggagtaa
              
                            

Download fasta file
RegulonDB