RegulonDB RegulonDB 10.9: Gene Sequence
rbsA gene sequence


Size: 1506        A: 378  T: 357  G: 415  C: 356

Fasta

 

>rbsA E. coli K12. Version NC_000913.3 GI:556503834
atggaagcattacttcagcttaaaggcatcgataaagccttcccgggcgtaaaagccctc
tcgggcgcagcgttaaatgtctatccgggccgcgtgatggcgctggtgggcgaaaacggc
gcgggtaaatccaccatgatgaaagtgcttactggcatctatactcgcgatgccggtacg
cttttatggctggggaaagaaacgacatttaccgggccaaaatcttcccaggaagccggg
attgggattatccatcaggaactgaacctgatcccgcagttgaccattgccgaaaacatt
ttcctcggtcgtgagtttgttaatcgctttggcaaaattgactggaaaaccatgtatgcc
gaagcggataaattgctggctaaacttaacctgcgctttaaaagcgacaagctggtgggc
gatctttccatcggtgaccagcaaatggttgaaatcgccaaagtgctgagctttgagtcg
aaagtcatcattatggatgaaccgaccgatgcgctgaccgataccgaaaccgaatccctg
ttccgcgtcatccgcgagctgaaatcgcaaggccgcggtattgtctatatctcccaccgc
atgaaagaaatcttcgagatttgcgatgacgttaccgtttttcgtgatgggcaatttatt
gctgagcgcgaagtggcatcactgaccgaagattcgctgattgagatgatggtgggtcgc
aagctggaagatcaatatccgcacctggacaaagcgccgggagatatccgcctgaaagtc
gataatctctgcggacctggcgttaacgatgtctcttttactttacgcaaaggcgaaatt
cttggcgtctctggtttgatgggcgcaggtcgtaccgaactgatgaaagtgctctacggc
gcactaccgcgcaccagcggttacgtcaccctggatgggcatgaagtcgttacccgttca
ccgcaggatggcctggcaaacggcattgtgtatatctccgaagaccgtaaacgtgacggt
ttagtgttgggcatgtcagtaaaagagaacatgtcgctgacagcgctgcgctacttcagc
cgcgctggcggcagtttgaagcatgccgatgaacagcaggctgtgagtgatttcattcgt
ctgtttaatgtgaaaactccgtcgatggaacaggcaattggtctgctttccggtggcaat
cagcaaaaagtggcgattgcccgcggtctgatgacacgccccaaagtgttgatccttgat
gaacctacccgtggcgtagatgtcggcgcgaaaaaagagatctatcaactgattaaccag
ttcaaagccgatggcttgagcatcattctggtgtcatcggagatgccagaagtattaggc
atgagcgatcgcatcatcgtcatgcatgaagggcatctcagcggggaatttactcgtgag
caggccacccaggaagtgttaatggctgccgctgtgggcaagcttaatcgcgtgaatcag
gagtaa
              
                            

Download fasta file
RegulonDB