RegulonDB RegulonDB 10.9: Gene Sequence
rbsC gene sequence


Size: 966        A: 184  T: 266  G: 283  C: 233

Fasta

 

>rbsC E. coli K12. Version NC_000913.3 GI:556503834
atgacaacccagactgtctctggtcgccgttatttcacgaaagcgtggctgatggagcag
aaatcgcttatcgctctgctggtgctgatcgcgattgtctcgacgttaagcccgaacttt
ttcaccatcaataacttattcaatattctccagcaaacctcagtgaacgccattatggcg
gtcgggatgacgctggtgatcctgacgtcgggcatcgacttatcggtaggttctctgttg
gcgctgaccggcgcagttgctgcatctatcgtcggcattgaagtcaatgcgctggtggct
gtcgctgctgctctcgcgttaggtgccgcaattggtgcggtaaccggggtgattgtagcg
aaaggtcgcgtccaggcgtttatcgctacgctggttatgatgcttttactgcgcggcgtg
accatggtttataccaacggtagcccagtgaataccggctttactgagaacgccgatctg
tttggctggtttggtattggtcgtccgctgggcgtaccgacgccagtctggatcatgggg
attgtcttcctcgcggcctggtacatgctgcatcacacgcgtctggggcgttacatctac
gcgctgggcggcaacgaagcggcaacgcgtctttctggtatcaacgtcaataaaatcaaa
atcatcgtctattctctttgtggtctgctggcatcgctggccgggatcattgaagtggcg
cgtctctcctccgcacaacccacggcggggactggctatgagctggatgctattgctgcg
gtggttctgggcggtacgagtctggcgggcggaaaaggtcgcattgttgggacgttgatc
ggcgcattaattcttggcttccttaataatggattgaatttgttaggtgtttcctcctat
taccagatgatcgtcaaagcggtggtgattttgctggcggtgctggtagacaacaaaaag
cagtaa
              
                            

Download fasta file
RegulonDB