RegulonDB RegulonDB 10.10: Gene Sequence
rbsR gene sequence


Size: 993        A: 246  T: 244  G: 250  C: 253

Fasta

 

>rbsR E. coli K12. Version NC_000913.3 GI:556503834
ttggctacaatgaaagatgttgcccgcctggcgggcgtttctacctcaacagtttctcac
gttatcaataaagatcgcttcgtcagtgaagcgattaccgccaaagttgaagcggcgatt
aaagaactcaattacgcgccatcagctctggcgcgtagcctcaaactcaatcaaacacat
accattggcatgttgatcactgccagtaccaatcctttctattcagaactggtgcgtggc
gttgaacgcagctgcttcgaacgcggttatagtctcgtcctttgcaataccgaaggcgat
gaacagcggatgaatcgcaatctggaaacgctgatgcaaaaacgcgttgatggcttgctg
ttactgtgcaccgaaacgcatcaaccttcgcgtgaaatcatgcaacgttatccgacagtg
cctactgtgatgatggactgggctccgttcgatggcgacagcgatcttattcaggataac
tcgttgctgggcggagacttagcaacgcaatatctgatcgataaaggtcatacccgtatc
gcctgtattaccggcccgctggataaaactccggcgcgcctgcggttggaaggttatcgg
gcggcgatgaaacgtgcgggtctcaacattcctgatggctatgaagtcactggtgatttt
gaatttaacggcgggtttgacgctatgcgccaactgctatcacatccgctgcgtcctcag
gccgtctttaccggaaatgacgctatggctgttggcgtttaccaggcgttatatcaggca
gagttacaggttccgcaggatatcgcggtgattggctatgacgatatcgaactggcaagc
tttatgacgccaccattaaccactatccaccaaccgaaagatgaactgggggagctggcg
attgatgtactcatccatcggataacccagccgacccttcagcaacaacgattacaactt
actccgattctgatggaacgcggttcggcttag
              
                            

Download fasta file
RegulonDB