RegulonDB RegulonDB 10.9: Gene Sequence
rcsA gene sequence


Size: 624        A: 200  T: 186  G: 121  C: 117

Fasta

 

>rcsA E. coli K12. Version NC_000913.3 GI:556503834
atgtcaacgattattatggatttatgtagttacacccgactaggtttaaccgggtatctg
ttgagtagaggggttaaaaaaagagaaatcaacgacattgaaaccgttgatgaccttgcc
atagcttgtgattcacagcgcccttcagtggtgtttattaatgaggactgtttcatccac
gatgcttctaacagtcagcgtatcaagctcatcattaatcaacatcccaatacgttattt
atcgtttttatggcaattgccaatgttcattttgatgaatatctattggtcagaaaaaat
ttattgatcagttctaaatcgattaaaccggaatctctcgacgatatccttggcgatatt
ctgaaaaaagagacaacgataacctcgtttttaaatatgccgacgttatcattgagccga
accgaatcgagtatgttgcgaatgtggatggcaggtcagggaaccattcaaatctctgac
caaatgaatatcaaagccaagaccgtttcatcgcataaaggtaatattaaacgtaagatc
aaaacgcataataaacaggttatctaccatgtcgtccgactgacggataatgtgactaat
ggtatttttgtcaacatgcgctaa
              
                            

Download fasta file
RegulonDB