RegulonDB RegulonDB 10.9: Gene Sequence
recG gene sequence


Size: 2082        A: 481  T: 410  G: 604  C: 587

Fasta

 

>recG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaggtcgcctgttagatgctgtcccactcagttccctaacgggcgttggcgcagca
cttagtaacaaactggcgaaaatcaacctgcataccgtgcaggatctactcttacacctt
cccctgcgctacgaagatcgcacccatctctaccccatcggagaactactgccgggcgtt
tatgccacggtggaaggcgaagtgctgaactgcaatatctccttcggcggtcggcggatg
atgacctgccagatcagcgacggttccggcatcctcaccatgcgctttttcaatttcagc
gcggcaatgaaaaatagcctggcggcgggccgccgtgtactggcttatggcgaagcaaag
cgcggtaaatatggtgcggagatgatccacccggaataccgcgtgcagggcgatctcagc
acgccagaattacaggaaacgctcacgccggtttatccaacaacggaaggcgtaaagcag
gccacgctgcgtaaattaaccgaccaggcgctggatctgctcgacacctgcgccattgaa
gaactcctgccgccggaactgtcacaaggaatgatgacgctaccggaagcgttgcgcact
ttgcaccgcccgccaccgacgctacagcttagcgatctggaaaccgggcagcatccggcg
caacgtcgtctgattctggaagaactgctggcgcacaacctcagcatgttagccttacgt
gccggagcacagcgttttcatgcccagccgctgagcgccaatgacacgctgaaaaataaa
ctcctcgccgccttaccgttcaagccaacgggcgcacaggcacgcgtagtggcggagatc
gagcgcgatatggcgctggatgtgccgatgatgcgtctggtgcagggcgatgtaggttcc
ggtaaaacgctggtcgccgccctcgccgcgttgcgtgcgattgcccacggcaaacaggta
gcattgatggcaccaaccgaattactcgccgagcagcacgccaataacttccgcaactgg
tttgcaccgctcggtatcgaagtgggctggctcgccggtaagcagaaaggtaaagcacgg
ctggcacagcaggaagccatcgccagcggtcaggtgcagatgattgtcggtacacacgcc
atcttccaggaacaggtgcagtttaacggcctggcgctggtgattatcgacgaacagcat
cgttttggcgtgcatcagcgtctggcattgtgggagaaaggccagcagcagggcttccat
ccgcatcagttgatcatgaccgccacgccgatcccccgcacgctggcaatgactgcgtat
gccgatctcgatacctcggtgatagatgagctgccgccaggccgcacgccagtgactacg
gtcgctattcctgatacccgccgtaccgacatcattgaccgcgtgcaccacgcctgcata
actgaaggtcgtcaggcatactgggtttgtacgttgattgaagagtcggaattgctggaa
gcgcaggcggcggaagctacctgggaagagttgaaactggcgctaccagagttgaacgtt
ggcctggtacacgggcggatgaaacctgccgagaaacaggcggtgatggcgtcgtttaaa
caaggtgagctacacctgctggttgccacaaccgttattgaagtcggcgttgatgtgcct
aacgccagtctgatgattatcgaaaacccggagcgtctgggtctggcgcagttacaccag
ctgcgcgggcgcgtaggtcgtggcgcggtggcttctcactgcgtgctgctctacaaaacg
ccgctttctaaaacggcgcaaattcgcctgcaagtgctgcgcgacagtaacgacggtttt
gtgattgcgcaaaaagatctggagattcgcggccctggcgaattgttaggcacgcgtcag
acgggtaatgctgaatttaaagtggcggatttactgcgcgatcaggcgatgatcccggaa
gttcagcgcctggcacgccatattcacgaacgttacccacaacaggcaaaagccctgata
gaacgctggatgccggagacggaacgttactcgaatgcgtaa
              
                            

Download fasta file
RegulonDB