RegulonDB RegulonDB 10.8: Gene Sequence
recN gene sequence


Size: 1662        A: 443  T: 358  G: 424  C: 437

Fasta

 

>recN E. coli K12. Version NC_000913.3 GI:556503834
atgttggcacaactgaccatcagcaactttgctatcgttcgtgagcttgagattgatttt
catagcggcatgaccgtaataactggcgagaccggcgcgggtaaatctattgcaatagat
gccctcggtctttgtctcggtggtcgcgctgaagccgacatggtgcgtaccggcgctgct
cgcgctgacctgtgcgcccgtttttctctgaaagatacgccagcggctctgcgctggctg
gaagaaaaccagcttgaagacgggcatgaatgtttgcttcgtcgcgtgatcagcagcgat
ggtcgctcccgtggtttcatcaacggtacagctgttcctctgtcacaactgcgcgaactg
ggtcagttgctgattcagatccatggtcagcacgctcatcaattactcaccaaacctgag
caccaaaaattcctgcttgatggctatgccaatgaaacctctctactgcaggaaatgacc
gcacgttatcagttgtggcatcaaagctgccgtgacctcgcgcatcatcaacagttaagt
caggaacgcgccgcccgtgcggaactgctgcaataccaattaaaagaacttaacgaattt
aatccgcagcccggagagtttgaacaaatcgacgaagagtacaaacgtctggcgaacagc
ggtcaattgctgaccaccagccagaatgcattggcattaatggccgacggtgaagacgca
aacctgcaaagtcagctttacacggctaaacaactggtgagcgaattgattggcatggac
agcaaactgtccggcgtacttgatatgctggaagaagctaccatccagattgctgaagcc
agcgatgaactgcgccactactgcgatcgtctggatctcgatcccaaccgactatttgaa
cttgaacagcgcatctcaaaacagatttcgctggcacgtaaacatcacgtcagccctgag
gcattgccacagtattaccagtcgctactggaagaacagcagcaactggacgatcaggcc
gactcacaagaaacgcttgcgctggcggtaacgaaacatcatcagcaggcactggaaatc
gcgcgcgcattacaccaacaacgccagcaatatgcagaagaacttgcacagctgatcacc
gacagtatgcatgcgctctcaatgccgcatgggcagtttacgatcgatgttaaatttgac
gagcatcacctgggcgctgacggtgccgatcgtattgagtttcgggtaaccaccaaccca
ggtcagccaatgcagcctattgccaaagtcgcatccggtggtgaattgtcccgcatcgca
ctggcaatccaggtcatcacggcgcgtaaaatggaaaccccggcactgatttttgatgaa
gtggatgtagggattagcggtccaacagcggcagttgtcggcaaactgctgcgtcaactc
ggcgaatcaactcaggtgatgtgtgttacccacctgccacaagtcgcgggatgtggtcat
caacactattttgtcagcaaagaaaccgatggtgcgatgacagaaacgcatatgcaatcc
ctgaataaaaaagcgcggttacaagagctggcgcgcctgcttggtggcagtgaagtcaca
cgtaatacactggcgaatgcgaaagaactgcttgcagcgtaa
              
                            

Download fasta file
RegulonDB