RegulonDB RegulonDB 10.8: Gene Sequence
relA gene sequence


Size: 2235        A: 547  T: 486  G: 652  C: 550

Fasta

 

>relA E. coli K12. Version NC_000913.3 GI:556503834
atggttgcggtaagaagtgcacatatcaataaggctggtgaatttgatccggaaaaatgg
atcgcaagtctgggtattaccagccagaagtcgtgtgagtgcttagccgaaacctgggcg
tattgtctgcaacagacgcaggggcatccggatgccagtctgttattgtggcgtggtgtt
gagatggtggagatcctctcgacattaagtatggacattgacacgctgcgggcggcgctg
cttttccctctggcggatgccaacgtagtcagcgaagatgtgctgcgtgagagcgtcggt
aagtcggtcgttaaccttattcacggcgtgcgtgatatggcggcgatccgccagctgaaa
gcgacgcacactgattctgtttcctccgaacaggtcgataacgttcgccggatgttattg
gcgatggtcgatgattttcgctgcgtagtcatcaaactggcggagcgtattgctcatctg
cgcgaagtaaaagatgcgccggaagatgaacgtgtactggcggcaaaagagtgtaccaac
atctacgcaccgctggctaaccgtctcggaatcggacaactgaaatgggaactggaagat
tactgcttccgttacctccatccaaccgaatacaaacgaattgccaaactgctgcatgaa
cggcgtctcgaccgcgaacactacatcgaagagttcgttggtcatctgcgcgctgagatg
aaagctgaaggcgttaaagcggaagtgtatggtcgtccgaaacacatctacagcatctgg
cgtaaaatgcagaaaaagaacctcgcctttgatgagctgtttgatgtgcgtgcggtacgt
attgtcgccgagcgtttacaggattgctatgccgcactggggatagtgcacactcactat
cgccacctgccggatgagtttgacgattacgtcgctaacccgaaaccaaacggttatcag
tctattcataccgtggttctggggccgggtggaaaaaccgttgagatccaaatccgcacc
aaacagatgcatgaagatgcagagttgggtgttgctgcgcactggaaatataaagagggc
gcggctgctggcggcgcacgttcgggacatgaagaccggattgcctggctgcgtaaactg
attgcgtggcaggaagagatggctgattccggcgaaatgctcgacgaagtacgtagtcag
gtctttgacgaccgggtgtacgtctttacgccgaaaggtgatgtcgttgatttgcctgcg
ggatcaacgccgctggacttcgcttaccacatccacagtgatgtcggacaccgctgcatc
ggggcaaaaattggcgggcgcattgtgccgttcacctaccagctgcagatgggcgaccag
attgaaattatcacccagaaacagccgaaccccagccgtgactggttaaacccaaacctc
ggttacgtcacaaccagccgtgggcgttcgaaaattcacgcctggttccgtaaacaggac
cgtgacaaaaacattctggctgggcggcaaatccttgacgacgagctggaacatctgggg
atcagcctgaaagaagcagaaaaacatctgctgccgcgttacaacttcaatgatgtcgac
gagttgctggcggcgattggtggcggggatatccgtctcaatcagatggtgaacttcctg
caatcgcaatttaataagccgagtgccgaagagcaggacgccgccgcgctgaagcaactt
cagcaaaaaagctacacgccgcaaaaccgcagtaaagataacggtcgcgtggtagtcgaa
ggtgttggcaacctgatgcaccacatcgcgcgctgctgccagccgattcctggagatgag
attgtcggcttcattacccaggggcgcggtatttcagtacaccgcgccgattgcgaacaa
ctggcggaactgcgctcccatgcgccagaacgcattgttgacgcggtatggggtgagagc
tactccgccggatattcgctggtggtccgcgtggtagctaatgatcgtagtgggttgtta
cgtgatatcacgaccattctcgccaacgagaaggtgaacgtgcttggcgttgccagccgt
agcgacaccaaacagcaactggcgaccatcgacatgaccattgagatttacaacctgcaa
gtgctggggcgcgtgctgggtaaactcaaccaggtgccggatgttatcgacgcgcgtcgg
ttgcacgggagttag
              
                            

Download fasta file
RegulonDB