RegulonDB RegulonDB 10.9: Gene Sequence
rfe gene sequence


Size: 1104        A: 214  T: 344  G: 280  C: 266

Fasta

 

>rfe E. coli K12. Version NC_000913.3 GI:556503834
gtgaatttactgacagtgagtactgatctcatcagtatttttttattcacgacactgttt
ctgttttttgcccgtaaggtggcaaaaaaagtcggtttagtggataaaccaaacttccgc
aaacgtcaccagggattgatacctctcgttggggggatttcggtttacgcagggatttgc
ttcacgttcggaattgtcgattactatattccgcatgcatctctctatctcgcttgtgcc
ggtgtgcttgttttcattggcgcgctggatgaccgttttgatatcagcgtaaaaatccgt
gccaccatacaggccgctgttggcattgttatgatggtgttcggcaagctttatctcagt
agcctgggttatatctttggctcctgggagatggtgctcggaccgtttggttacttcctg
acgctatttgccgtctgggcggccattaatgcgttcaacatggttgatggcattgatggc
ttgctgggcgggttgtcctgcgtctcgtttgcagcaatcggtatgattttgtggttcgac
gggcaaaccagcctcgcaatctggtgctttgcgatgatcgccgccatcctgccatacatc
atgcttaaccttggtatcctgggtcgccgctacaaagtctttatgggtgatgcgggcagt
acgctgattggttttaccgttatctggatcctgctcgaaacgacccagggcaaaacccat
cccatcagcccggttaccgctttgtggataatcgccattccgctaatggatatggtggcg
attatgtaccgtcgcctgcgtaaaggcatgagcccattctctcctgaccgtcagcatatt
caccatttgatcatgcgtgccgggtttacttcccgtcaggcgtttgtgctgattaccctt
gccgcagcactgctcgcttccattggcgtgctggcagaatattctcattttgtcccggag
tgggtcatgctggtgctctttttgctagcattcttcctctatggatattgcattaagcgt
gcctggaaagttgctcgctttattaagcgcgtaaaacgcagactgcgtagaaatcgtggt
ggcagccccaatttaaccaaataa
              
                            

Download fasta file
RegulonDB