RegulonDB RegulonDB 10.9: Gene Sequence
rhaR gene sequence


Size: 849        A: 193  T: 230  G: 229  C: 197

Fasta

 

>rhaR E. coli K12. Version NC_000913.3 GI:556503834
gtggcgcatcagttaaaacttctcaaagatgatttttttgccagcgaccagcaggcagtc
gctgtggctgaccgttatccgcaagatgtctttgctgaacatacacatgatttttgtgag
ctggtgattgtctggcgcggtaatggcctgcatgtactcaacgatcgcccttatcgcatt
acccgtggcgatctcttttacattcatgctgacgataaacactcctacgcttccgttaac
gatctggttttgcagaatattatttattgcccggagcgtctgaagctgaatcttgactgg
cagggggcgattccgggatttaacgccagcgcagggcaaccacactggcgcttaggtagc
atggggatggcgcaggcgcggcaggttatcggtcagcttgagcatgaaagtagtcagcat
gtgccgtttgctaacgaaatggctgagttgctgttcgggcagttggtgatgttgctgaat
cgccatcgttacaccagtgattcgttgccgccaacatccagcgaaacgttgctggataag
ctgattacccggctggcggctagcctgaaaagtccctttgcgctggataaattttgtgat
gaggcatcgtgcagtgagcgcgttttgcgtcagcaatttcgccagcagactggaatgacc
atcaatcaatatctgcgacaggtcagagtgtgtcatgcgcaatatcttctccagcatagc
cgcctgttaatcagtgatatttcgaccgaatgtggctttgaagatagtaactatttttcg
gtggtgtttacccgggaaaccgggatgacgcccagccagtggcgtcatctcaattcgcag
aaagattaa
              
                            

Download fasta file
RegulonDB