RegulonDB RegulonDB 10.8: Gene Sequence
rna gene sequence


Size: 807        A: 206  T: 188  G: 201  C: 212

Fasta

 

>rna E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcattctggcgtaacgccgcgttgctcgcggtttctctgcttcccttctcttct
gccaacgccttagcgttgcaggcaaaacagtatggcgattttgatcgctatgtcctggcc
ctctcctggcaaaccggattttgccagagtcaacacgatcgaaatcgtaacgaacgagat
gaatgtcgcctgcaaaccgaaacgaccaacaaagctgattttctgaccgtacatggtctg
tggccaggattgcctaaatcggttgctgcccgtggtgttgatgaacgccgctggatgcgc
ttcggttgcgctactcgcccaatcccgaatctaccagaagcgcgcgccagccgaatgtgt
tcatcgccggaaaccggattatcactggaaacggccgctaaactaagtgaagtcatgcca
ggagctggcggacgttcctgcctggaacgctacgaatatgccaaacacggtgcctgcttt
ggttttgatccggacgcatacttcggtacgatggtacgcctgaatcaagaaattaaagag
agcgaagccggaaaattccttgcggataattacggtaaaacagtgagccgccgtgacttt
gacgccgcctttgccaaaagctggggaaaagagaacgtgaaagcagttaagctaacgtgc
cagggtaaccctgcgtatttgactgaaattcagatctcgatcaaagctgacgccatcaac
gctccgctttctgcaaactcattcttgccacaacctcacccaggtaactgtggcaaaacc
tttgtgattgataaagcgggttattaa
              
                            

Download fasta file
RegulonDB