RegulonDB RegulonDB 10.8: Gene Sequence
rnc gene sequence


Size: 681        A: 175  T: 161  G: 184  C: 161

Fasta

 

>rnc E. coli K12. Version NC_000913.3 GI:556503834
atgaaccccatcgtaattaatcggcttcaacggaagctgggctacacttttaatcatcag
gaactgttgcagcaggcattaactcatcgtagtgccagcagtaaacataacgagcgttta
gaatttttaggcgactctattctgagctacgttatcgccaatgcgctttatcaccgtttc
cctcgtgtggatgaaggcgatatgagccggatgcgcgccacgctggtccgtggcaatacg
ctggcggaactggcgcgcgaatttgagttaggcgagtgcttacgtttagggccaggtgaa
cttaaaagcggtggatttcgtcgtgagtcaattctcgccgacaccgtcgaagcattaatt
ggtggcgtattcctcgacagtgatattcaaaccgtcgagaaattaatcctcaactggtat
caaactcgtttggacgaaattagcccaggcgataaacaaaaagatccgaaaacgcgcttg
caagaatatttgcagggtcgccatctgccgctgccgacttatctggtagtccaggtacgt
ggcgaagcgcacgatcaggaatttactatccactgccaggtcagcggcctgagtgaaccg
gtggttggcacaggttcaagccgtcgtaaggctgagcaggctgccgccgaacaggcgttg
aaaaaactggagctggaatga
              
                            

Download fasta file
RegulonDB