RegulonDB RegulonDB 10.9: Gene Sequence
rplT gene sequence


Size: 357        A: 97  T: 88  G: 86  C: 86

Fasta

 

>rplT E. coli K12. Version NC_000913.3 GI:556503834
atggctcgcgtaaaacgtggtgttattgcacgtgcacgtcacaagaaaattttgaaacaa
gctaaaggctactacggtgcgcgttctcgcgtataccgcgttgccttccaggctgttatc
aaagctggtcagtatgcttaccgtgaccgtcgtcaacgtaagcgtcagttccgtcaactg
tggattgcgcgtatcaacgcagcagcacgtcagaacggtatttcttacagcaaattcatc
aatggcctgaaaaaagcctctgttgaaatcgaccgtaagatcctggctgatatcgcagta
ttcgacaaagtagcgttcaccgctctggttgaaaaagcgaaagcagctctggcataa
              
                            

Download fasta file
RegulonDB