RegulonDB RegulonDB 10.10: Gene Sequence
rpoH gene sequence


Size: 855        A: 212  T: 180  G: 246  C: 217

Fasta

 

>rpoH E. coli K12. Version NC_000913.3 GI:556503834
atgactgacaaaatgcaaagtttagctttagccccagttggcaacctggattcctacatc
cgggcagctaacgcgtggccgatgttgtcggctgacgaggagcgggcgctggctgaaaag
ctgcattaccatggcgatctggaagcagctaaaacgctgatcctgtctcacctgcggttt
gttgttcatattgctcgtaattatgcgggctatggcctgccacaggcggatttgattcag
gaaggtaacatcggcctgatgaaagcagtgcgccgtttcaacccggaagtgggtgtgcgc
ctggtctccttcgccgttcactggatcaaagcagagatccacgaatacgttctgcgtaac
tggcgtatcgtcaaagttgcgaccaccaaagcgcagcgcaaactgttcttcaacctgcgt
aaaaccaagcagcgtctgggctggtttaaccaggatgaagtcgaaatggtggcccgtgaa
ctgggcgtaaccagcaaagacgtacgtgagatggaatcacgtatggcggcacaggacatg
acctttgacctgtcttccgacgacgattccgacagccagccgatggctccggtgctctat
ctgcaggataaatcatctaactttgccgacggcattgaagatgataactgggaagagcag
gcggcaaaccgtctgaccgacgcgatgcagggtctggacgaacgcagccaggacatcatc
cgtgcgcgctggctggacgaagacaacaagtccacgttgcaggaactggctgaccgttac
ggcgtttccgctgagcgtgtacgccagctggaaaagaacgcgatgaaaaaattgcgtgct
gccattgaagcgtaa
              
                            

Download fasta file
RegulonDB