RegulonDB RegulonDB 10.9: Gene Sequence
rpoN gene sequence


Size: 1434        A: 377  T: 299  G: 376  C: 382

Fasta

 

>rpoN E. coli K12. Version NC_000913.3 GI:556503834
atgaagcaaggtttgcaactcaggcttagccaacaactggcgatgacgccacagctccaa
caggcaattcgtctgttgcagttgtcgacgctggaacttcagcaggagctacagcaggcg
ctggagagtaatccgctgcttgagcaaatcgacactcatgaagaaatcgacacccgcgaa
acgcaagacagtgaaacgctggacaccgccgacgcgctcgaacaaaaagagatgccggaa
gagctgccgctcgatgccagttgggacaccatttacaccgctggtacaccatccggcacc
agcggtgactacattgacgacgagctgccggtctaccagggcgaaacgacgcagaccttg
caggattacctgatgtggcaggttgagctgacaccgttttccgacactgaccgcgctatt
gctacctctatcgtcgatgccgttgatgaaaccggttatctgactgtcccgctggaagat
attctcgaaagtataggcgatgaagagatcgacatcgacgaagttgaagccgtccttaag
cggatccaacggtttgatccggtcggtgtggcggcaaaagatctgcgtgactgtctgctg
atccaactctcccaattcgataagaccacgccgtggctggaagaggccagactgatcatt
agcgatcatctcgatctgttagccaatcacgacttccgcactttaatgcgcgtcacgcgt
ctgaaagaagatgtgctgaaagaagccgtcaatctgatccagtcgctcgatccgcgcccc
gggcagtcgatccagactggcgaacctgagtatgtcattccagatgtgctggtgcgtaag
cataacggtcactggacggtagaactcaacagtgacagcattccgcgtctgcaaatcaac
cagcactacgcctcgatgtgcaataacgcgcgcaacgatggtgacagccagtttatccgc
agcaatctgcaggatgccaaatggttgatcaagagtctggaaagccgtaacgatacgcta
ctgcgcgtgagtcgctgtatcgttgaacagcagcaagccttctttgagcaaggtgaagaa
tatatgaaaccgatggtactggccgatatcgcccaggctgtcgaaatgcatgaatcgacg
atatctcgcgtgaccacgcaaaaatacctgcatagtccacgaggcatttttgaactgaag
tatttcttttccagtcacgtcaataccgagggcggcggcgaagcttcctccacggcgatt
cgtgcgctggtgaagaaattaatcgcggcggaaaacccagcgaaaccgttgagcgacagc
aagttaacctctttgctgtcggaacaaggtatcatggtggcacgccgcactgttgcgaag
taccgagagtctttatccattccgccgtcaaaccagcgtaaacaactcgtttga
              
                            

Download fasta file
RegulonDB