RegulonDB RegulonDB 10.9: Gene Sequence
rpsA gene sequence


Size: 1674        A: 448  T: 369  G: 459  C: 398

Fasta

 

>rpsA E. coli K12. Version NC_000913.3 GI:556503834
atgactgaatcttttgctcaactctttgaagagtccttaaaagaaatcgaaacccgcccg
ggttctatcgttcgtggcgttgttgttgctatcgacaaagacgtagtactggttgacgct
ggtctgaaatctgagtccgccatcccggctgagcagttcaaaaacgcccagggcgagctg
gaaatccaggtaggtgacgaagttgacgttgctctggacgcagtagaagacggcttcggt
gaaactctgctgtcccgtgagaaagctaaacgtcacgaagcctggatcacgctggaaaaa
gcttacgaagatgctgaaactgttaccggtgttatcaacggcaaagttaagggcggcttc
actgttgagctgaacggtattcgtgcgttcctgccaggttctctggtagacgttcgtccg
gtgcgtgacactctgcacctggaaggcaaagagcttgaatttaaagtaatcaagctggat
cagaagcgcaacaacgttgttgtttctcgtcgtgccgttatcgaatccgaaaacagcgca
gagcgcgatcagctgctggaaaacctgcaggaaggcatggaagttaaaggtatcgttaag
aacctcactgactacggtgcattcgttgatctgggcggcgttgacggcctgctgcacatc
actgacatggcctggaaacgcgttaagcatccgagcgaaatcgtcaacgtgggcgacgaa
atcactgttaaagtgctgaagttcgaccgcgaacgtacccgtgtatccctgggcctgaaa
cagctgggcgaagatccgtgggtagctatcgctaaacgttatccggaaggtaccaaactg
actggtcgcgtgaccaacctgaccgactacggctgcttcgttgaaatcgaagaaggcgtt
gaaggcctggtacacgtttccgaaatggactggaccaacaaaaacatccacccgtccaaa
gttgttaacgttggcgatgtagtggaagttatggttctggatatcgacgaagaacgtcgt
cgtatctccctgggtctgaaacagtgcaaagctaacccgtggcagcagttcgcggaaacc
cacaacaagggcgaccgtgttgaaggtaaaatcaagtctatcactgacttcggtatcttc
atcggcttggacggcggcatcgacggcctggttcacctgtctgacatctcctggaacgtt
gcaggcgaagaagcagttcgtgaatacaaaaaaggcgacgaaatcgctgcagttgttctg
caggttgacgcagaacgtgaacgtatctccctgggcgttaaacagctcgcagaagatccg
ttcaacaactgggttgctctgaacaagaaaggcgctatcgtaaccggtaaagtaactgca
gttgacgctaaaggcgcaaccgtagaactggctgacggcgttgaaggttacctgcgtgct
tctgaagcatcccgtgaccgcgttgaagacgctaccctggttctgagcgttggcgacgaa
gttgaagctaaattcaccggcgttgatcgtaaaaaccgcgcaatcagcctgtctgttcgt
gcgaaagacgaagctgacgagaaagatgcaatcgcaactgttaacaaacaggaagatgca
aacttctccaacaacgcaatggctgaagctttcaaagcagctaaaggcgagtaa
              
                            

Download fasta file
RegulonDB