RegulonDB RegulonDB 10.8: Gene Sequence
rpsT gene sequence


Size: 264        A: 89  T: 52  G: 57  C: 66

Fasta

 

>rpsT E. coli K12. Version NC_000913.3 GI:556503834
ttggctaatatcaaatcagctaagaagcgcgccattcagtctgaaaaggctcgtaagcac
aacgcaagccgtcgctctatgatgcgtactttcatcaagaaagtatacgcagctatcgaa
gctggcgacaaagctgctgcacagaaagcatttaacgaaatgcaaccgatcgtggaccgt
caggctgctaaaggtctgatccacaaaaacaaagctgcacgtcataaggctaacctgact
gcacagatcaacaaactggcttaa
              
                            

Download fasta file
RegulonDB