RegulonDB RegulonDB 10.8: Gene Sequence
ftnA gene sequence


Size: 498        A: 158  T: 127  G: 97  C: 116

Fasta

 

>ftnA E. coli K12. Version NC_000913.3 GI:556503834
atgctgaaaccagaaatgattgaaaaacttaatgagcagatgaacctggaactgtactct
tcactgctttatcagcaaatgagcgcctggtgcagctatcataccttcgaaggtgctgcc
gcgttcctgcgccgtcacgcccaggaagagatgacgcatatgcagcgtctgtttgattac
ctgactgataccggcaatttaccgcgtattaataccgttgaatctccgtttgctgaatat
tcctcacttgatgaattattccaggaaacctataaacacgaacaattaatcacccagaaa
attaacgaactggctcatgctgcaatgaccaatcaggactacccaacatttaatttcctg
caatggtatgtttctgagcagcatgaagaagagaaactgttcaaatcgattattgataaa
ttaagcctggcaggcaaaagcggcgaaggtctgtattttatcgacaaagaactctctacc
ctcgacacacaaaactaa
              
                            

Download fasta file
RegulonDB