RegulonDB RegulonDB 10.9: Gene Sequence
sbmA gene sequence


Size: 1221        A: 240  T: 354  G: 328  C: 299

Fasta

 

>sbmA E. coli K12. Version NC_000913.3 GI:556503834
atgtttaagtcttttttcccaaagccgggaacgttttttctctcggccttcgtttgggca
ttgattgccgttatcttctggcaagccggtgggggtgactgggtggcgcgtatcaccggc
gcttccgggcagatcccgattagcgccgcgcgtttctggtcgttggatttcctgattttt
tacgcttactacattgtttgcgtaggactttttgcattgttctggtttatctacagcccg
catcgttggcaatactggtcaatactcggtactgcactgatcatcttcgtcacctggttt
ttggtggaagtcggggtcgccgtcaacgcctggtatgcgccgttctatgatctgattcaa
accgcgctaagttcgccgcataaagtcaccatcgaacaattttaccgcgaagtgggcgtc
tttctggggattgcgctgatcgctgtggtgatcagtgtgctgaacaacttctttgtcagt
cactacgtgttccgctggcgtacagcgatgaacgaatattacatggcgaactggcaacaa
ctgcgtcatatcgaaggggccgcacagcgtgtgcaggaagacaccatgcgttttgcttca
acgctggagaatatgggcgtcagttttatcaacgccatcatgacgttgatcgccttcctg
ccggtgctggtaacgctctccgcgcatgtgccggagctgccgattatcgggcacattccg
tatggtctggtgattgccgcaatcgtctggtcgctgatggggaccggattgctggcagtg
gtagggatcaaactgccggggctggagtttaaaaaccagcgtgtagaggctgcctaccgt
aaagagctggtttatggtgaagacgatgccacgcgcgcgacgccgcctacggtacgcgag
ctgtttagcgccgtacggaaaaactatttccgcctctattttcactatatgtatttcaac
atcgcccgcattctctatttgcaggtcgataacgttttcggtttgttcttgctgtttccg
tcaattgttgccggtacgattacgctcggcctgatgacgcagattaccaacgtttttggt
caggttcgcggtgctttccagtacctgattaactcatggaccacactggttgagttgatg
tctatctacaaacgtctgcgcagctttgaacatgagctggatggtgacaaaattcaggaa
gtaacccataccttgagctaa
              
                            

Download fasta file
RegulonDB