RegulonDB RegulonDB 10.9: Gene Sequence
sbp gene sequence


Size: 990        A: 277  T: 212  G: 275  C: 226

Fasta

 

>sbp E. coli K12. Version NC_000913.3 GI:556503834
atgaacaagtggggcgtagggttaacatttttgctggcggcaaccagcgttatggcaaag
gatattcagcttcttaacgtttcatatgatccaacgcgcgaattgtacgaacagtacaac
aaggcattcagcgcccactggaaacagcaaactggtgataacgtggtgattcgtcagtca
cacggtggctcaggtaaacaagcgacgtcggtaatcaacggtattgaagctgatgttgtc
acgctggctctggcctatgacgtggacgcaattgcggaacgcgggcggattgataaagag
tggatcaaacgtctgccggataactccgcaccgtacacttccaccattgttttcctggta
cgtaagggaaatccgaagcagatccatgactggaacgatctgattaaaccgggtgtttcg
gtgatcacgcctaatccgaaaagctctggtggcgcgcgctggaactacctggcagcctgg
ggctacgcgctgcatcacaacaacaacgatcaggcaaaagcacaggattttgttcgggca
ctgtataaaaacgtcgaagttctggattctggcgcgcgtggctccactaacacttttgtc
gagcgcggaattggcgatgtactgattgcctgggaaaacgaagctctgctggcagcgaat
gaactggggaaagataaattcgaaatcgtcacgccgagtgagtctatcctcgcagagcca
accgtgtcggtggtcgataaagtggtcgagaaaaaaggtactaaagaggtggcggaagcc
tacctgaaatatctctactcgccagaaggtcaggaaattgccgcgaaaaactactaccgt
ccgcgcgacgctgaggtggcgaaaaagtacgaaaatgcgtttccaaagctgaagttattc
accattgatgaagagttcggcggctggacgaaagcgcaaaaagagcattttgctaacggc
ggtacgttcgatcagatcagcaaacgctga
              
                            

Download fasta file
RegulonDB