RegulonDB RegulonDB 10.9: Gene Sequence
sdhC gene sequence


Size: 390        A: 84  T: 114  G: 91  C: 101

Fasta

 

>sdhC E. coli K12. Version NC_000913.3 GI:556503834
atgataagaaatgtgaaaaaacaaagacctgttaatctggacctacagaccatccggttc
cccatcacggcgatagcgtccattctccatcgcgtttccggtgtgatcacctttgttgca
gtgggcatcctgctgtggcttctgggtaccagcctctcttcccctgaaggtttcgagcaa
gcttccgcgattatgggcagcttcttcgtcaaatttatcatgtggggcatccttaccgct
ctggcgtatcacgtcgtcgtaggtattcgccacatgatgatggattttggctatctggaa
gaaacattcgaagcgggtaaacgctccgccaaaatctcctttgttattactgtcgtgctt
tcacttctcgcaggagtcctcgtatggtaa
              
                            

Download fasta file
RegulonDB