RegulonDB RegulonDB 10.8: Gene Sequence
secF gene sequence


Size: 972        A: 208  T: 262  G: 277  C: 225

Fasta

 

>secF E. coli K12. Version NC_000913.3 GI:556503834
gtggcacaggaatatactgttgaacaactaaaccacggccgtaaagtctatgactttatg
cgctgggactactgggctttcggcatctctggtctgctgttaatcgctgctatcgttatt
atgggcgtgcgcggctttaactgggggctggatttcaccggtggtacggttattgaaatt
acgctcgaaaaaccggctgaaattgacgtaatgcgtgatgcattgcaaaaagccggtttt
gaagagccgatgctgcaaaactttggtagcagccatgacatcatggtccgtatgccgcct
gctgaaggcgaaaccggcggtcaggtgttgggcagccaggttctgaaggtgattaacgaa
tccaccaatcagaatgcagcagtgaagcgtattgagttcgtcggtccgagcgtgggggca
gaccttgcgcaaaccggtgcgatggcgttgatggcagcgctgctgtctatcctcgtgtac
gtaggtttccgctttgagtggcgactggcggcaggggtggttattgcgctggcgcacgac
gttatcattacgctgggtattttgtcgttattccatatcgagattgacctgaccattgtg
gcatcgttgatgtcggttatcggttactcgcttaacgacagtatcgtggtatcggaccgt
attcgtgaaaacttccgcaagatccgtcgcggtacgccttacgaaatctttaacgtgtcc
ttgacccagacgctgcaccgtaccttgatcacatccggtactaccttgatggttatcctg
atgctgtacctcttcggtggtccggtactggaaggcttctcgctgaccatgcttatcggt
gtttccatcggtactgcatcttccatctatgtggcatctgcgttggctctgaaactgggt
atgaagcgcgaacacatgttgcagcagaaagtggaaaaagaaggggcggatcagccgtca
attctgccgtaa
              
                            

Download fasta file
RegulonDB