RegulonDB RegulonDB 10.8: Gene Sequence
serS gene sequence


Size: 1293        A: 323  T: 289  G: 361  C: 320

Fasta

 

>serS E. coli K12. Version NC_000913.3 GI:556503834
atgctcgatcccaatctgctgcgtaatgagccagacgcagtcgctgaaaaactggcacgc
cggggctttaagctggatgtagataagctgggcgctcttgaagagcgtcgtaaagtattg
caggtcaaaacggaaaacctgcaagcggagcgtaactcccgatcgaaatccattggccag
gcgaaagcgcgcggggaagatatcgagcctttacgtctggaagtgaacaaactgggcgaa
gagctggatgcagcaaaagccgagctggatgctttacaggctgaaattcgcgatatcgcg
ctgaccatccctaacctgcctgcagatgaagtgccggtaggtaaagacgaaaatgacaac
gttgaagtcagccgctggggtaccccgcgtgagtttgactttgaagttcgtgaccacgtg
acgctgggtgaaatgcactctggcctcgactttgcagctgcagttaagctgactggttcc
cgctttgtggtaatgaaagggcagattgctcgcatgcaccgcgcactgtcgcagtttatg
ctggatctgcataccgaacagcatggctacagtgagaactatgttccgtacctggttaac
caggacacgctgtacggtacgggtcaactgccgaaatttgctggcgatctgttccatact
cgtccgctggaagaagaagcagacaccagtaactatgcgctgatcccaacggcagaagtt
ccgctgactaacctggtgcgcggtgaaatcatcgatgaagatgatctgccaattaagatg
accgcccacaccccatgcttccgttctgaagccggttcatatggtcgtgacacccgtggt
ctgatccgtatgcaccagttcgacaaagttgaaatggtgcagatcgtgcgcccagaagac
tcaatggcggcgctggaagagatgactggtcatgcagaaaaagtcctgcagttgctgggc
ctgccgtaccgtaaaatcatcctttgcactggcgacatgggctttggcgcttgcaaaact
tacgacctggaagtatggatcccggcacagaacacctaccgtgagatctcttcctgctcc
aacgtttgggatttccaggcacgtcgtatgcaggcacgttgccgcagcaagtcggacaag
aaaacccgtctggttcataccctgaacggttctggtctggctgttggtcgtacgctggtt
gcagtaatggaaaactatcagcaggctgatggtcgtattgaagtaccagaagttctgcgt
ccgtatatgaacggactggaatatattggctaa
              
                            

Download fasta file
RegulonDB