RegulonDB RegulonDB 10.8: Gene Sequence
maeA gene sequence


Size: 1698        A: 433  T: 382  G: 449  C: 434

Fasta

 

>maeA E. coli K12. Version NC_000913.3 GI:556503834
atggaaccaaaaacaaaaaaacagcgttcgctttatatcccttacgctggccctgtactg
ctggaatttccgttgttgaataaaggcagtgccttcagcatggaagaacgccgtaacttc
aacctgctggggttactgccggaagtggtcgaaaccatcgaagaacaagcggaacgagca
tggatccagtatcagggattcaaaaccgaaatcgacaaacacatctacctgcgtaacatc
caggacactaacgaaaccctcttctaccgtctggtaaacaatcatcttgatgagatgatg
cctgttatttataccccaaccgtcggcgcagcctgtgagcgtttttctgagatctaccgc
cgttcacgcggcgtgtttatctcttaccagaaccggcacaatatggacgatattctgcaa
aacgtgccgaaccataatattaaagtgattgtggtgactgacggtgaacgcattctgggg
cttggtgaccagggcatcggcgggatgggcattccgatcggtaaactgtcgctctatacc
gcctgtggcggcatcagcccggcgtatacccttccggtggtgctggatgtcggaacgaac
aaccaacagctgcttaacgatccgctgtatatgggctggcgtaatccgcgtatcactgac
gacgaatactatgaattcgttgatgaatttatccaggctgtgaaacaacgctggccagac
gtgctgttgcagtttgaagactttgctcaaaaaaatgcgatgccgttacttaaccgctat
cgcaatgaaatttgttcttttaacgatgacattcagggcactgcggcggtaacagtcggc
acactgatcgcagcaagccgcgcggcaggtggtcagttaagcgagaaaaaaatcgtcttc
cttggcgcaggttcagcgggatgcggcattgccgaaatgatcatctcccagacccagcgc
gaaggattaagcgaggaagcggcgcggcagaaagtctttatggtcgatcgctttggcttg
ctgactgacaagatgccgaacctgctgcctttccagaccaaactggtgcagaagcgcgaa
aacctcagtgactgggataccgacagcgatgtgctgtcactgctggatgtggtgcgcaat
gtaaaaccagatattctgattggcgtctcaggacagaccgggctgtttacggaagagatc
atccgtgagatgcataaacactgtccgcgtccgatcgtgatgccgctgtctaacccgacg
tcacgcgtggaagccacaccgcaggacattatcgcctggaccgaaggtaacgcgctggtc
gccacgggcagcccgtttaatccagtggtatggaaagataaaatctaccctatcgcccag
tgtaacaacgcctttattttcccgggcatcggcctgggtgttattgcttccggcgcgtca
cgtatcaccgatgagatgctgatgtcggcaagtgaaacgctggcgcagtattcaccattg
gtgctgaacggcgaaggtatggtactgccggaactgaaagatattcagaaagtctcccgc
gcaattgcgtttgcggttggcaaaatggcgcagcagcaaggcgtggcggtgaaaacctct
gccgaagccctgcaacaggccattgacgataatttctggcaagccgaataccgcgactac
cgccgtacctccatctaa
              
                            

Download fasta file
RegulonDB