RegulonDB RegulonDB 10.9: Gene Sequence
slt gene sequence


Size: 1938        A: 469  T: 412  G: 574  C: 483

Fasta

 

>slt E. coli K12. Version NC_000913.3 GI:556503834
gtggaaaaagccaaacaagttacctggcggctgttggctgccggtgtctgtctgctgacg
gtcagcagcgtggcgcgagccgactcactggatgagcagcgtagtcgttacgcgcaaatc
aagcaggcctgggataatcgacaaatggatgtggtcgaacaaatgatgcctggactgaag
gattatccgctttatccctacctggaataccgccagatcaccgatgatctgatgaatcaa
ccggcggtgacggtcactaactttgttcgcgctaaccccacgcttcctcccgctcgcacg
ctgcaatctcgtttcgtcaatgaactggcgcggcgtgaagactggcgtggcttgttagcc
tttagcccggaaaagcccggaactaccgaagcgcaatgtaattactactatgcgaaatgg
aacaccgggcagagtgaagaagcctggcaaggggcgaaagagctgtggctaaccggcaag
agccagcctaacgcctgtgacaagttatttagcgtctggcgtgcgtcaggtaaacaagat
ccgctggcgtatttagagcgtatccgtctggcgatgaaagcgggtaacacaggcctggta
acagtgctggcagggcagatgcctgccgattaccagactatcgcctcggcaatcatttca
ctggcgaacaaccctaatacggtactgaccttcgcgcgtacaactggcgcgaccgatttt
acccgtcaaatggcggcggtggcgtttgccagtgtggcgcggcaggatgctgagaatgca
cggctgatgatcccatcgcttgcccaggcgcagcagcttaatgaagatcagattcaggag
ctgcgcgatatcgtcgcctggcgtttgatgggcaacgatgtcaccgacgagcaggcgaaa
tggcgcgatgacgccattatgcgctcgcaatctacttcgcttattgaacgccgtgtacga
atggcgcttggcaccggcgatcgtcgcggcctgaatacctggctggcgcgtctgcctatg
gaagcgaaagagaaagatgaatggcgttactggcaggcggatttattgctggaacgcgga
cgtgaagctgaagcaaaagagattttgcatcaactcatgcaacagcgtggtttctacccg
atggttgcagcacaacgcatcggcgaagagtatgagctgaagattgataaagcgccgcag
aatgttgacagcgccctgactcaggggccggagatggcgcgcgtgcgcgagttgatgtac
tggaatctcgataataccgcgcgtagcgagtgggccaatctggtgaagagcaagtcaaaa
acagagcaggctcaactggcgcggtatgctttcaacaaccaatggtgggatcttagcgtt
caggcaacgatcgccgggaagctgtgggatcatctggaagagcgattcccgctggcttac
aacgatcttttcaaacgctacaccagcggtaaggagatcccgcaaagctatgcgatggcg
attgctcgtcaggagagcgcctggaatccgaaagtgaaatcaccggtaggggccagcggc
ttgatgcagattatgcctggtacagcgacccatacggtgaagatgttctctattcccggt
tatagcagtcctgggcaattgctggatccggaaacgaatatcaacattggcaccagttac
ctgcaatatgtttatcagcagtttggcaataatcgtattttctcctcagcagcttataac
gccggaccagggcgggtgcgaacctggcttggcaacagcgccgggcgtatcgacgcagtg
gcatttgtcgagagtattccattctccgagacgcgcggttatgtgaagaacgtgctggct
tatgacgcttactaccgctatttcatgggggataaaccgacgttgatgagcgccacggaa
tggggacgtcgttactga
              
                            

Download fasta file
RegulonDB