RegulonDB RegulonDB 10.9: Gene Sequence
sodA gene sequence


Size: 621        A: 165  T: 125  G: 161  C: 170

Fasta

 

>sodA E. coli K12. Version NC_000913.3 GI:556503834
atgagctataccctgccatccctgccgtatgcttacgatgccctggaaccgcacttcgat
aagcagaccatggaaatccaccacaccaaacaccatcagacctacgtaaacaacgccaac
gcggcgctggaaagcctgccagaatttgccaacctgccggttgaagagctgatcaccaaa
ctggaccagctgccagcagacaagaaaaccgtactgcgcaacaacgctggcggtcacgct
aaccacagcctgttctggaaaggtctgaaaaaaggcaccaccctgcagggtgacctgaaa
gcggctatcgaacgtgacttcggctccgttgataacttcaaagcagaatttgaaaaagcg
gcagcttcccgctttggttccggctgggcatggctggtgctgaaaggcgataaactggcg
gtggtttctactgctaaccaggattctccgctgatgggtgaagctatttctggcgcttcc
ggcttcccgattatgggcctggatgtgtgggaacatgcttactacctgaaattccagaac
cgccgtccggactacattaaagagttctggaacgtggtgaactgggacgaagcagcggca
cgttttgcggcgaaaaaataa
              
                            

Download fasta file
RegulonDB