RegulonDB RegulonDB 10.8: Gene Sequence
speA gene sequence


Size: 1977        A: 449  T: 455  G: 567  C: 506

Fasta

 

>speA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgacgacatgtctatgggtttgccttcgtcagcgggcgaacacggtgtactacgc
tccatgcaggaggttgcaatgagctcccaggaagccagcaagatgctgcgtacttacaat
attgcctggtggggcaataactactatgacgttaacgagctgggccacattagcgtgtgc
ccggacccggacgtcccggaagctcgcgtcgatctcgcgcagttagtgaaaactcgtgaa
gcacagggccagcgtctgcctgcactgttctgtttcccacagatcctgcagcaccgtttg
cgttccattaacgccgcgttcaaacgtgcgagggaatcctacggctataacggcgattac
ttccttgtttatccgatcaaagttaaccagcaccgccgcgtgattgagtccctgattcat
tcgggcgaaccgctgggtctggaagccggttccaaagccgagttgatggcagtactggca
catgctggcatgacccgtagcgtcatcgtctgcaacggttataaagaccgcgaatatatc
cgcctggcattaattggcgagaagatggggcacaaggtctatctggtcattgagaagatg
tcagaaatcgccattgtgctggatgaagcagaacgtctgaatgtcgttcctcgtctgggc
gtgcgtgcacgtctggcttcgcagggttcgggtaaatggcagtcctccggcggggaaaaa
tcgaagttcggcctggctgcgactcaggtactgcaactggttgaaaccctgcgtgaagcc
gggcgtctcgacagcctgcaactactgcacttccacctcggttcgcagatggcgaatatt
cgcgatatcgcgacaggcgttcgtgaatccgcgcgtttctatgtggaactgcacaagctg
ggcgtcaatattcagtgcttcgacgtcggcggcggtctgggcgtggattatgaaggtact
cgttcgcagtccgactgttcggtgaactacggcctcaatgaatacgccaacaacattatc
tgggcgattggcgatgcgtgtgaagaaaacggtctgccgcatccgacggtaatcaccgaa
tcgggtcgtgcggtgactgcgcatcacaccgtgctggtgtctaatatcatcggcgtggaa
cgtaacgaatacacggtgccgaccgcgcctgcagaagatgcgccgcgcgcgctgcaaagc
atgtgggaaacctggcaggagatgcacgaaccgggaactcgccgttctctgcgtgaatgg
ttacacgacagtcagatggatctgcacgacattcatatcggctactcttccggcatcttt
agcctgcaagaacgtgcatgggctgagcagctttatttgagcatgtgccatgaagtgcaa
aagcagctggatccgcaaaaccgtgctcatcgtccgattatcgacgagctgcaggaacgt
atggcggacaaaatgtacgtcaacttctcgctgttccagtcgatgccggacgcatggggg
atcgaccagttgttcccggttctgccgctggaagggctggatcaagtgccggaacgtcgc
gctgtgctgctggatattacctgtgactctgacggtgctatcgaccactatattgatggt
gacggtattgccacgacaatgccaatgccggagtacgatccagagaatccgccgatgctc
ggtttctttatggtcggcgcatatcaggagatcctcggcaacatgcacaacctgttcggt
gataccgaagcggttgacgtgttcgtcttccctgacggtagcgtagaagtagaactgtct
gacgaaggcgataccgtggcggacatgctgcaatatgtacagctcgatccgaaaacgctg
ttaacccagttccgcgatcaagtgaagaaaaccgatcttgatgctgaactgcaacaacag
ttccttgaagagttcgaggcaggtttgtacggttatacttatcttgaagatgagtaa
              
                            

Download fasta file
RegulonDB