RegulonDB RegulonDB 10.8: Gene Sequence
speB gene sequence


Size: 921        A: 195  T: 223  G: 268  C: 235

Fasta

 

>speB E. coli K12. Version NC_000913.3 GI:556503834
atgagcaccttaggtcatcaatacgataactcactggtttccaatgcctttggtttttta
cgcctgccgatgaacttccagccgtatgacagcgatgcagactgggtgattactggcgtg
ccgttcgatatggccacttctggtcgtgcgggtggtcgccacggtccggcagcgatccgt
caggtttcgacgaatctggcctgggaacacaaccgcttcccgtggaatttcgacatgcgt
gagcgtctgaacgtcgtggactgcggcgatctggtatatgcctttggcgatgcccgtgag
atgagcgaaaagctgcaggcgcacgccgagaagctgctggctgccggtaagcgtatgctc
tctttcggtggtgaccactttgttacgctgccgctgctgcgtgctcatgcgaagcatttc
ggcaaaatggcgctggtacactttgacgcccacaccgatacctatgcgaacggttgtgaa
tttgaccacggcactatgttctataccgcgccgaaagaaggtctgatcgacccgaatcat
tccgtgcagattggtattcgtaccgagtttgataaagacaacggctttaccgtgctggac
gcctgccaggtgaacgatcgcagcgtggatgacgttatcgcccaagtgaaacagattgtg
ggtgatatgccggtttacctgacttttgatatcgactgcctggatcctgcttttgcacca
ggcaccggtacgccagtgattggcggcctgacctccgatcgcgctattaaactggtacgc
ggcctgaaagatctcaacattgttgggatggacgtagtggaagtggctccggcatacgat
cagtcggaaatcactgctctggcagcggcaacgctggcgctggaaatgctgtatattcag
gcggcgaaaaagggcgagtaa
              
                            

Download fasta file
RegulonDB