RegulonDB RegulonDB 10.9: Gene Sequence
trmH gene sequence


Size: 690        A: 165  T: 143  G: 190  C: 192

Fasta

 

>trmH E. coli K12. Version NC_000913.3 GI:556503834
atgaacccaacacgttatgcacgcatctgcgaaatgctcgccaggcggcagcctgatctg
accgtctgcatggagcaggtccacaaacctcataacgtttctgcgattattcgtaccgca
gatgccgttggcgtacatgaagttcacgccgtctggcctggtagccgcatgcgcaccatg
gcttcggcagcggcgggtagtaacagctgggtacaggtgaaaacacaccgcaccattggc
gatgccgtcgctcatctcaaaggccagggcatgcagattctggcaacccatctttctgat
aacgctgtcgatttccgcgaaattgattacactcgcccgacctgcattttgatgggacag
gagaaaacgggcatcacgcaggaagcattggccctggcggatcaggacatcatcattccg
atgatcggcatggtgcagtcgctgaatgtttccgttgcctcagccctcattctttacgaa
gcccagcgtcagcggcaaaatgcaggcatgtacctgcgtgaaaacagcatgttgccggaa
gcagagcaacaacgcctgttgtttgaaggcggctatccggtgctggcgaaagtcgcaaaa
cgcaaaggcctgccttatccccacgtcaatcagcaaggcgagatcgaagctgatgccgac
tggtgggctactatgcaggctgcagggtaa
              
                            

Download fasta file
RegulonDB