RegulonDB RegulonDB 10.8: Gene Sequence
srlE gene sequence


Size: 960        A: 196  T: 239  G: 267  C: 258

Fasta

 

>srlE E. coli K12. Version NC_000913.3 GI:556503834
atgacgcatattcggatcgaaaaaggaacgggtggctggggcggcccgcttgagctgaaa
gccacgccgggaaaaaaaatcgtctatatcaccgccggtacccggcctgcgattgttgac
aaactggcacagcttactggctggcaggctattgacggatttaaagaaggtgaacccgcg
gaggcggaaattggtgtcgcggtaatcgactgtggcggcacattacgctgcggcatctat
ccgaaacgacgtattcccaccattaatatccactcgacgggcaagtccggtccgctggcg
cagtacattgtggaagatatttatgtctctggcgtaaaagaagaaaacatcactgtagta
ggtgatgcgacaccacaaccctcttccgtgggccgtgactatgacaccagtaagaaaatc
accgaacaaagcgatggtttactggcgaaggtgggaatgggcatggggtccaccgttgcg
gtgctgtttcaatctggtcgtgacaccatcgacactgtattaaaaaccattctgccgttt
atggcattcgtctcggcgctcattggcatcattatggcttctggccttggtgactggatt
gcccacggtcttgctccgctggcgagccatccactgggtctggtcatgctggcgctcatc
tgttccttcccactgctttcacctttcctcggcccaggcgcagttatcgcacaggttatc
ggcgtattgattggcgtgcagattggtctcggcaatattccgccgcatctggctttaccg
gcactgtttgccatcaacgcgcaggcggcctgcgacttcatcccggtcggtttgtcgctg
gcggaagcccgtcaggacacggttcgcgtcggtgtcccttctgtactggtgagccgcttt
ttaaccggcgcgccgactgtactgatcgcctggtttgtctccggttttatctatcaatag
              
                            

Download fasta file
RegulonDB