RegulonDB RegulonDB 10.8: Gene Sequence
gutQ gene sequence


Size: 966        A: 216  T: 196  G: 292  C: 262

Fasta

 

>gutQ E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaagcactactgaacgcgggacgtcagacgttaatgctggagttgcaggaagca
agccgtttaccggaacgtctgggcgatgattttgttcgcgccgccaatatcatcctgcac
tgtgaaggcaaagtggtggtttcgggaattggcaaatcgggccacattggtaagaaaatc
gccgcaacgcttgccagtaccggcactccggctttttttgtccatccggcagaagcgctg
cacggcgatctggggatgatcgaaagccgcgatgtgatgctgtttatctcttactccggt
ggcgcgaaggaactggatctgattattccgcgtctggaagataaatctatcgcgctgctg
gcgatgaccggcaaaccgacgtcaccgctgggcctggcggcaaaagcggtgctggatatc
tccgtagaacgcgaagcctgcccgatgcaccttgcgccgacctccagcaccgtcaatacc
ctgatgatgggtgacgcgctggcgatggcggtcatgcaggcgcgcggatttaatgaagaa
gattttgcccgctcccacccagccggggcactgggcgctcgcttgctgaataaagtgcat
catctgatgcgccgtgacgatgccatcccacaggtggcgttaaccgccagcgtgatggat
gcgatgctggaactcagccgcaccggtctggggctggtggcggtatgtgacgctcaacaa
caggtacaaggcgtctttaccgacggcgatttacgtcgctggctggttggcggcggcgca
ctcaccacgccagtcaatgaagcgatgacggtcggcggcaccacgttgcaatcgcaaagt
cgcgccatcgacgccaaagagatcctgatgaagcgcaaaatcactgccgcaccggtggtg
gatgaaaacggcaaactcaccggcgcaataaacctgcaggatttctatcaggccgggatt
atttaa
              
                            

Download fasta file
RegulonDB