RegulonDB RegulonDB 10.9: Gene Sequence
sucA gene sequence


Size: 2802        A: 641  T: 601  G: 781  C: 779

Fasta

 

>sucA E. coli K12. Version NC_000913.3 GI:556503834
atgcagaacagcgctttgaaagcctggttggactcttcttacctctctggcgcaaaccag
agctggatagaacagctctatgaagacttcttaaccgatcctgactcggttgacgctaac
tggcgttcgacgttccagcagttacctggtacgggagtcaaaccggatcaattccactct
caaacgcgtgaatatttccgccgcctggcgaaagacgcttcacgttactcttcaacgatc
tccgaccctgacaccaatgtgaagcaggttaaagtcctgcagctcattaacgcataccgc
ttccgtggtcaccagcatgcgaatctcgatccgctgggactgtggcagcaagataaagtg
gccgatctggatccgtctttccacgatctgaccgaagcagacttccaggagaccttcaac
gtcggttcatttgccagcggcaaagaaaccatgaaactcggcgagctgctggaagccctc
aagcaaacctactgcggcccgattggtgccgagtatatgcacattaccagcaccgaagaa
aaacgctggatccaacagcgtatcgagtctggtcgcgcgactttcaatagcgaagagaaa
aaacgcttcttaagcgaactgaccgccgctgaaggtcttgaacgttacctcggcgcaaaa
ttccctggcgcaaaacgcttctcgctggaaggcggtgacgcgttaatcccgatgcttaaa
gagatgatccgccacgctggcaacagcggcacccgcgaagtggttctcgggatggcgcac
cgtggtcgtctgaacgtgctggtgaacgtgctgggtaaaaaaccgcaagacttgttcgac
gagttcgccggtaaacataaagaacacctcggcacgggtgacgtgaaataccacatgggc
ttctcgtctgacttccagaccgatggcggcctggtgcacctggcgctggcgtttaacccg
tctcaccttgagattgtaagcccggtagttatcggttctgttcgtgcccgtctggacaga
cttgatgagccgagcagcaacaaagtgctgccaatcaccatccacggtgacgccgcagtg
accgggcagggcgtggttcaggaaaccctgaacatgtcgaaagcgcgtggttatgaagtt
ggcggtacggtacgtatcgttatcaacaaccaggttggtttcaccacctctaatccgctg
gatgcccgttctacgccgtactgtactgatatcggtaagatggttcaggccccgattttc
cacgttaacgcggacgatccggaagccgttgcctttgtgacccgtctggcgctcgatttc
cgtaacacctttaaacgtgatgtcttcatcgacctggtgtgctaccgccgtcacggccac
aacgaagccgacgagccgagcgcaacccagccgctgatgtatcagaaaatcaaaaaacat
ccgacaccgcgcaaaatctacgctgacaagctggagcaggaaaaagtggcgacgctggaa
gatgccaccgagatggttaacctgtaccgcgatgcgctggatgctggcgattgcgtagtg
gcagagtggcgtccgatgaacatgcactctttcacctggtcgccgtacctcaaccacgaa
tgggacgaagagtacccgaacaaagttgagatgaagcgcctgcaggagctggcgaaacgc
atcagcacggtgccggaagcagttgaaatgcagtctcgcgttgccaagatttatggcgat
cgccaggcgatggctgccggtgagaaactgttcgactggggcggtgcggaaaacctcgct
tacgccacgctggttgatgaaggcattccggttcgcctgtcgggtgaagactccggtcgc
ggtaccttcttccaccgccacgcggtgatccacaaccagtctaacggttccacttacacg
ccgctgcaacatatccataacgggcagggcgcgttccgtgtctgggactccgtactgtct
gaagaagcagtgctggcgtttgaatatggttatgccaccgcagaaccacgcactctgacc
atctgggaagcgcagttcggtgacttcgccaacggtgcgcaggtggttatcgaccagttc
atctcctctggcgaacagaaatggggccggatgtgtggtctggtgatgttgctgccgcac
ggttacgaagggcaggggccggagcactcctccgcgcgtctggaacgttatctgcaactt
tgtgctgagcaaaacatgcaggtttgcgtaccgtctaccccggcacaggtttaccacatg
ctgcgtcgtcaggcgctgcgcgggatgcgtcgtccgctggtcgtgatgtcgccgaaatcc
ctgctgcgtcatccgctggcggtttccagcctcgaagaactggcgaacggcaccttcctg
ccagccatcggtgaaatcgacgagcttgatccgaagggcgtgaagcgcgtagtgatgtgt
tctggtaaggtttattacgacctgctggaacagcgtcgtaagaacaatcaacacgatgtc
gccattgtgcgtatcgagcaactctacccgttcccgcataaagcgatgcaggaagtgttg
cagcagtttgctcacgtcaaggattttgtctggtgccaggaagagccgctcaaccagggc
gcatggtactgcagccagcatcatttccgtgaagtgattccgtttggggcttctctgcgt
tatgcaggccgcccggcctccgcctctccggcggtagggtatatgtccgttcaccagaaa
cagcaacaagatctggttaatgacgcgctgaacgtcgaataa
              
                            

Download fasta file
RegulonDB