RegulonDB RegulonDB 10.9: Gene Sequence
sucC gene sequence


Size: 1167        A: 286  T: 247  G: 347  C: 287

Fasta

 

>sucC E. coli K12. Version NC_000913.3 GI:556503834
atgaacttacatgaatatcaggcaaaacaactttttgcccgctatggcttaccagcaccg
gtgggttatgcctgtactactccgcgcgaagcagaagaagccgcttcaaaaatcggtgcc
ggtccgtgggtagtgaaatgtcaggttcacgctggtggccgcggtaaagcgggcggtgtg
aaagttgtaaacagcaaagaagacatccgtgcttttgcagaaaactggctgggcaagcgt
ctggtaacgtatcaaacagatgccaatggccaaccggttaaccagattctggttgaagca
gcgaccgatatcgctaaagagctgtatctcggtgccgttgttgaccgtagttcccgtcgt
gtggtctttatggcctccaccgaaggcggcgtggaaatcgaaaaagtggcggaagaaact
ccgcacctgatccataaagttgcgcttgatccgctgactggcccgatgccgtatcaggga
cgcgagctggcgttcaaactgggtctggaaggtaaactggttcagcagttcaccaaaatc
ttcatgggcctggcgaccattttcctggagcgcgacctggcgttgatcgaaatcaacccg
ctggtcatcaccaaacagggcgatctgatttgcctcgacggcaaactgggcgctgacggc
aacgcactgttccgccagcctgatctgcgcgaaatgcgtgaccagtcgcaggaagatccg
cgtgaagcacaggctgcacagtgggaactgaactacgttgcgctggacggtaacatcggt
tgtatggttaacggcgcaggtctggcgatgggtacgatggacatcgttaaactgcacggc
ggcgaaccggctaacttccttgacgttggcggcggcgcaaccaaagaacgtgtaaccgaa
gcgttcaaaatcatcctctctgacgacaaagtgaaagccgttctggttaacatcttcggc
ggtatcgttcgttgcgacctgatcgctgacggtatcatcggcgcggtagcagaagtgggt
gttaacgtaccggtcgtggtacgtctggaaggtaacaacgccgaactcggcgcgaagaaa
ctggctgacagcggcctgaatattattgcagcaaaaggtctgacggatgcagctcagcag
gttgttgccgcagtggaggggaaataa
              
                            

Download fasta file
RegulonDB