RegulonDB RegulonDB 10.8: Gene Sequence
sucD gene sequence


Size: 870        A: 218  T: 184  G: 240  C: 228

Fasta

 

>sucD E. coli K12. Version NC_000913.3 GI:556503834
atgtccattttaatcgataaaaacaccaaggttatctgccagggctttaccggtagccag
gggactttccactcagaacaggccattgcatacggcactaaaatggttggcggcgtaacc
ccaggtaaaggcggcaccacccacctcggcctgccggtgttcaacaccgtgcgtgaagcc
gttgctgccactggcgctaccgcttctgttatctacgtaccagcaccgttctgcaaagac
tccattctggaagccatcgacgcaggcatcaaactgattatcaccatcactgaaggcatc
ccgacgctggatatgctgaccgtgaaagtgaagctggatgaagcaggcgttcgtatgatc
ggcccgaactgcccaggcgttatcactccgggtgaatgcaaaatcggtatccagcctggt
cacattcacaaaccgggtaaagtgggtatcgtttcccgttccggtacactgacctatgaa
gcggttaaacagaccacggattacggtttcggtcagtcgacctgtgtcggtatcggcggt
gacccgatcccgggctctaactttatcgacattctcgaaatgttcgaaaaagatccgcag
accgaagcgatcgtgatgatcggtgagatcggcggtagcgctgaagaagaagcagctgcg
tacatcaaagagcacgttaccaagccagttgtgggttacatcgctggtgtgactgcgccg
aaaggcaaacgtatgggccacgcgggtgccatcattgccggtgggaaagggactgcggat
gagaaattcgctgctctggaagccgcaggcgtgaaaaccgttcgcagcctggcggatatc
ggtgaagcactgaaaactgttctgaaataa
              
                            

Download fasta file
RegulonDB