RegulonDB RegulonDB 10.8: Gene Sequence
surA gene sequence


Size: 1287        A: 337  T: 257  G: 349  C: 344

Fasta

 

>surA E. coli K12. Version NC_000913.3 GI:556503834
atgaagaactggaaaacgctgcttctcggtatcgccatgatcgcgaataccagtttcgct
gccccccaggtagtcgataaagtcgcagccgtcgtcaataacggcgtcgtgctggaaagc
gacgttgatggattaatgcagtcggtaaaactgaacgctgctcaggcaaggcagcaactt
cctgatgacgcgacgctgcgccaccaaatcatggaacgtttgatcatggatcaaatcatc
ctgcagatggggcagaaaatgggagtgaaaatctccgatgagcagctggatcaggcgatt
gctaacatcgcgaaacagaacaacatgacgctggatcagatgcgcagccgtctggcttac
gatggactgaactacaacacctatcgtaaccagatccgcaaagagatgattatctctgaa
gtgcgtaacaacgaggtgcgtcgtcgcatcaccatcctgccgcaggaagtcgaatccctg
gcgcagcaggtgggtaaccaaaacgacgccagcactgagctgaacctgagccacatcctg
atcccgctgccggaaaacccgacctctgatcaggtgaacgaagcggaaagccaggcgcgc
gccattgtcgatcaggcgcgtaacggcgctgatttcggtaagctggcgattgctcattct
gccgaccagcaggcgctgaacggcggccagatgggctggggccgtattcaggagttgccc
gggatcttcgcccaggcattaagcaccgcgaagaaaggcgacattgttggcccgattcgt
tccggcgttggcttccatattctgaaagttaacgacctgcgcggcgaaagcaaaaatatc
tcggtgaccgaagttcatgctcgccatattctgctgaaaccgtcgccgatcatgactgac
gaacaggcccgtgtgaaactggaacagattgctgctgatatcaagagtggtaaaacgact
tttgctgccgcagcgaaagagttctctcaggatccaggctctgctaaccagggcggcgat
ctcggctgggctacaccagatattttcgatccggccttccgtgacgccctgactcgcctg
aacaaaggtcaaatgagtgcaccggttcactcttcattcggctggcatttaatcgaactg
ctggatacccgtaatgtcgataaaaccgacgctgcgcagaaagatcgtgcataccgcatg
ctgatgaaccgtaagttctcggaagaagcagcaagctggatgcaggaacaacgtgccagc
gcctacgttaaaatcctgagcaactaa
              
                            

Download fasta file
RegulonDB