RegulonDB RegulonDB 10.8: Gene Sequence
tap gene sequence


Size: 1602        A: 403  T: 341  G: 475  C: 383

Fasta

 

>tap E. coli K12. Version NC_000913.3 GI:556503834
atgtttaatcgtattcgaatttcgaccacgctgtttttaattttgattctctgcgggatc
ttgcagattggcagtaacggcatgtctttttgggcatttcgcgacgatttgcaacgactg
aatcaggtcgagcagagcaatcagcaacgtgcggcattagcgcaaactcgggcggtaatg
ttacaggccagtaccgcgctgaacaaagcgggcactctgacggcacttagctatccggcg
gatgacattaaaacgttgatgacgacggcgcgcgccagtctgacgcaatccaccacgctg
tttaaaagttttatggcgatgactgcgggcaacgagcacgtcaggggattgcaaaaagag
acggagaaaagttttgcccgctggcacaacgatctcgaacatcaggcgacctggcttgaa
agtaatcaactttcggatttcctcactgcgccggtgcagggatcacagaatgcgtttgac
gttaactttgaggcctggcagctggagatcaaccatgtgctggaagccgccagtgcgcaa
agccagcgtaactatcagatttcggcactggtgtttatcagcatgattattgttgcggcg
atctacatcagcagtgcgctgtggtggacgcgcaagatgattgttcaaccactggccatt
atcggtagccattttgacagcattgctgcgggtaatctggcgcgtccgattgcggtatat
ggtcgtaatgagatcaccgccatttttgccagtctgaagaccatgcagcaggctttgcgt
gggacggtaagtgatgtgcgtaagggaagccaggagatgcacattggtatcgcggagatt
gtcgcaggcaataacgatctctcaagtcgtaccgaacagcaggcggcatcgctggcacaa
acggccgccagtatggagcaattaaccgccacggtagggcaaaacgccgataacgcacga
caggcgtcggaactggcaaaaaatgccgcgacaacggcgcaggcgggcggtgttcaggtc
agtaccatgactcacaccatgcaggagatcgccaccagctcgcaaaaaattggcgacatt
atcagcgttatcgacggaattgctttccagaccaatattctggccctgaatgcggcagtg
gaagcggctcgcgccggagagcaggggcgtggttttgcggtagtggcaggtgaagtgcgc
aatcttgccagccgtagcgcgcaggcagcaaaagagatcaaagggctgatcgaagagtca
gtcaatcgtgtccagcagggttcgaaactggtgaataacgccgccgcgaccatgatcgat
attgtcagttcggtgacccgcgtgaacgacattatgggagaaattgcctctgcgtcggaa
gaacaacagcgggggattgagcaggttgcacaggctgtcagccagatggatcaggtgact
cagcagaacgcctcgctggtagaagaagcggcggtggcaacggaacaactggcgaatcag
gccgaccatctttcgtcgcgtgtggcggtatttacccttgaagaacatgaagtagcacga
catgagtcggtgcagttacaaattgcgccagtggtatcctga
              
                            

Download fasta file
RegulonDB