RegulonDB RegulonDB 10.8: Gene Sequence
tgt gene sequence


Size: 1128        A: 268  T: 281  G: 305  C: 274

Fasta

 

>tgt E. coli K12. Version NC_000913.3 GI:556503834
atgaaatttgaactggacaccaccgacggtcgcgcacgccgtggccgcctggtctttgat
cgtggcgtagtggaaacgccttgttttatgcctgttggcacctacggcaccgtaaaaggg
atgacgccggaagaagttgaagccactggcgcgcaaattatcctcggcaacaccttccac
ctgtggctgcgcccgggccaggaaatcatgaaactgcacggcgatctgcacgattttatg
cagtggaaggggccgatcctcaccgactccggcggcttccaggtcttcagccttggcgat
attcgtaaaatcaccgaacagggcgtgcacttccgtaacccgatcaacggcgatccgatt
ttcctcgatcctgaaaaatcaatggagattcagtacgatcttggttcggatatcgtcatg
atctttgatgagtgtacgccgtatcctgctgactgggattacgcaaaacgctccatggag
atgtctctgcgttgggcgaagcgtagccgtgagcgttttgacagtctcggaaacaaaaat
gcgctgtttggtatcatccagggcagcgtttacgaagatttacgtgatatttctgttaaa
ggtctggtagatatcggttttgatggctacgctgtcggcggtctggctgtgggtgagccg
aaagcagatatgcaccgcattctggagcatgtatgcccgcaaattccggcagacaaaccg
cgttacctgatgggcgttggtaaaccagaagacctggttgaaggcgtacgtcgtggtatc
gatatgtttgactgcgtaatgccaacccgcaacgcccgaaatggtcatttgttcgtgacc
gatggcgtggtgaaaatccgcaatgcgaagtataagagcgatactggcccactcgatcct
gagtgtgattgctacacctgtcgcaattattcacgcgcttacttgcatcatcttgaccgt
tgcaacgaaatattaggcgcgcgactcaacaccattcataaccttcgttactaccagcgt
ttgatggcgggtttacgcaaggctattgaagagggtaaattagagagcttcgtaactgat
ttttaccagcgtcaggggcgagaagtaccacctttgaacgttgattaa
              
                            

Download fasta file
RegulonDB