RegulonDB RegulonDB 10.8: Gene Sequence
treA gene sequence


Size: 1698        A: 469  T: 341  G: 437  C: 451

Fasta

 

>treA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcccccgcaccttctcgcccgcaaaaaatggcgttaattccagcctgtatcttt
ttgtgtttcgctgcgctatcggtgcaggcagaagaaacaccggtaacaccacagccgcct
gatattttattagggccgctgtttaatgatgtgcaaaacgccaaactttttccggaccaa
aaaacctttgccgatgccgtgccgaacagcgatccgctgatgatccttgctgattatcgg
atgcagcaaaaccagagcggatttgatctgcgccatttcgttaacgtcaatttcaccctg
ccgaaagaaggcgagaaatatgttccgccagaggggcagtcactgcgcgaacatattgac
ggactttggccggtattaacgcgttctaccgaaaacaccgaaaaatgggattctctgtta
ccgctgccggaaccttatgtcgtgccgggcggacgctttcgcgaggtatattactgggac
agttacttcaccatgttaggacttgccgaaagcggtcactgggataaagtcgcggatatg
gtggccaattttgctcatgaaatagacacttacggtcatattcccaacggcaaccgcagt
tactatttaagccgctcgcaaccgcccttctttgccctgatggtagagttactggcgcag
catgaaggcgatgccgcgttgaagcaatacctgccgcaaatgcaaaaagaatatgcttac
tggatggacggtgttgaaaacctgcaagccggacaacaggaaaaacgcgttgtcaaactt
caggatggtacccttctcaaccgctactgggacgatcgcgatacgccacgaccagagtca
tgggtggaagatattgccaccgccaaaagcaatccgaatcgacctgccactgaaatttac
cgcgacctgcgctctgccgctgcgtctggctgggatttcagctcgcgctggatggacaac
ccgcagcagttaaataccttacgcaccaccagcatcgtaccggtcgatctgaacagcctg
atgtttaaaatggaaaaaatcctcgcccgcgccagcaaagctgccggagataacgcgatg
gcaaaccagtacgaaacgctggcaaatgcccgtcaaaaagggatcgaaaaatacctgtgg
aacgatcaacaaggctggtatgccgattacgacctgaaaagtcataaagtgcgcaatcag
ttaaccgcggccgccctgttcccgctgtacgtcaatgcggcagcgaaagatcgcgccaac
aaaatggcgacggcgacgaaaacacatctgctgcaacccggcggcctgaacaccacgtcg
gtgaaaagtgggcaacaatgggatgcgccaaatggctgggcaccgttacagtgggtcgcg
acagaaggattacaaaactacgggcaaaaagaggtggcgatggacattagctggcacttc
ctgaccaatgttcagcacacctatgaccgggagaaaaagctggtggaaaaatatgatgtc
agcaccaccggaacggggggcggcggtggcgaatatccattacaggatggctttggctgg
accaatggcgtgacgctgaaaatgctggatttgatctgcccgaaagagcaaccgtgtgac
aatgttccggcgacgcgtccgaccgttaagtcagcaacgacgcaaccctcaaccaaagag
gcacaacccacaccttaa
              
                            

Download fasta file
RegulonDB