RegulonDB RegulonDB 10.9: Gene Sequence
trpR gene sequence


Size: 327        A: 83  T: 67  G: 96  C: 81

Fasta

 

>trpR E. coli K12. Version NC_000913.3 GI:556503834
atggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggtta
cgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaac
ctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagag
ctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcatcgcg
acgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctg
gaagaggtgttgctgaaaagcgattga
              
                            

Download fasta file
RegulonDB