RegulonDB RegulonDB 10.10: Gene Sequence
tsr gene sequence


Size: 1656        A: 402  T: 349  G: 505  C: 400

Fasta

 

>tsr E. coli K12. Version NC_000913.3 GI:556503834
atgttaaaacgtatcaaaattgtgaccagcttactgctggttttggccgtttttggcctt
ttacaactgacatcaggcggtctgttctttaatgccttaaagaatgacaaagaaaatttc
actgttttacaaaccattcgccagcagcaatccacgctgaatggcagctgggtcgcgttg
ttgcagacgcgtaacaccctcaaccgcgcgggtatccgctacatgatggatcagaataat
attggtagcggttcaaccgttgctgagctgatggagagtgccagtatttcgctgaaacag
gcggaaaaaaactgggcggattacgaagcgttgccgcgtgacccgcgtcagagcaccgcc
gcagcggcagagatcaaacgtaattacgatatttatcacaatgcgctggcggagctgatc
caactgttaggtgcaggcaaaatcaacgagttctttgatcagccgacccagggatatcag
gacggtttcgagaagcagtatgtggcttacatggagcaaaacgatcggctccatgatatc
gccgtcagcgataacaatgcctcctacagccaggcgatgtggattctggtgggcgtgatg
atcgtcgtactggcggtcatcttcgccgtctggttcggtattaaagcctcgctggtagcg
ccaatgaatcgcctgattgacagcattcgtcatattgcaggcggcgatctggtgaaaccg
attgaggtggatggctctaatgagatggggcaactggcagagagtttgcgccatatgcag
ggagagctgatgcgtaccgtcggtgatgtgcgcaacggggccaatgccatctatagcggt
gccagcgaaatcgccaccggcaataacgatctctcttcgcgcaccgagcaacaggccgct
tcgctggaagagacggcagccagcatggagcaactgaccgcaacggtgaagcagaacgcc
gaaaatgcgcgccaggccagccatctggcgttaagtgcttctgaaacggcgcaacgcggc
ggtaaagtggtagataacgtggtgcagactatgcgcgatatctccaccagttcgcagaaa
atcgccgatattatcagcgtaattgacggcattgccttccagaccaatattctggctttg
aacgcggcggttgaggctgcgcgtgcgggtgagcaagggcgcggttttgcggtggtcgcg
ggagaagtgcgtaatctggcccagcgcagcgcccaggcggctcgtgaaattaaaagcctg
attgaagactcggtggggaaagtggatgttggctctacgctggtcgaaagcgccggggaa
acaatggcggagattgtcagcgccgtgacccgcgtgacggacattatgggcgaaattgct
tctgcttctgatgagcagagccgtggtatcgatcaggttggcttagcggttgctgagatg
gaccgggtaactcaacagaacgccgcgctggtggaagagtctgccgctgccgccgccgcg
ctggaagagcaggccagtcgcctgaccgaagcagtggcagtgttccggattcagcaacag
cagcgtgaaacatcggctgtggtaaaaaccgtgacgccagctgcgccgcgtaaaatggcc
gtggcagatagcgaggagaactgggaaacattttaa
              
                            

Download fasta file
RegulonDB